View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1271_high_83 (Length: 347)
Name: NF1271_high_83
Description: NF1271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1271_high_83 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 307; Significance: 1e-173; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 30 - 336
Target Start/End: Original strand, 30805139 - 30805445
Alignment:
| Q |
30 |
tttgggtgtctgctgtggaggcttattttacggcagcagggaccgctggggcggagacggcgaaaggggtgtttttagggctgttaggtaggtgtcatgt |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30805139 |
tttgggtgtctgctgtggaggcttattttacggcagcagggaccgctggggcggagacggcgaaaggggtgtttttagggctgttaggtaggtgtcatgt |
30805238 |
T |
 |
| Q |
130 |
tagtgctggtgccgcggtgagggtggcgagtagggtgctcggaggcagtggagaagggagtaaagtgagggctaaagtggttgctgagcttgtgtctgat |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30805239 |
tagtgctggtgccgcggtgagggtggcgagtagggtgctcggaggcagtggagaagggagtaaagtgagggctaaagtggttgctgagcttgtgtctgat |
30805338 |
T |
 |
| Q |
230 |
gaaagggtagtggcgctttttgcagaaaaggatgctgctaaggatagaactgcaatgcatgctgttctgtggaattggtatgataatgttattacttttg |
329 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30805339 |
gaaagggtagtggcgctttttgcagaaaaggatgctgctaaggatagaactgcaatgcatgctgttctgtggaattggtatgataatgttattacttttg |
30805438 |
T |
 |
| Q |
330 |
ggttcat |
336 |
Q |
| |
|
||||||| |
|
|
| T |
30805439 |
ggttcat |
30805445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 267 - 336
Target Start/End: Original strand, 30806812 - 30806881
Alignment:
| Q |
267 |
ctaaggatagaactgcaatgcatgctgttctgtggaattggtatgataatgttattacttttgggttcat |
336 |
Q |
| |
|
||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
30806812 |
ctaaggatagaacagcaatgcatgctgttctttggaattggtatgataatgttattactctttggttcat |
30806881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University