View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1271_high_87 (Length: 341)
Name: NF1271_high_87
Description: NF1271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1271_high_87 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 30 - 328
Target Start/End: Original strand, 24983880 - 24984176
Alignment:
| Q |
30 |
gatcaaatcacatgcgcgcccggcaccatctagtctgctgggcttggactacatggcaaattaagatcctgtccatgccatctcaacgtcacacttctaa |
129 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| ||||||||||||||| |||| |||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
24983880 |
gatcaaatcacatgagcgcccggcaccatctagtcagctgggcttggacta--tggcgaattaagatcctgtccatgccatctcaacgtcacgcttctaa |
24983977 |
T |
|
| Q |
130 |
atatgtttgcgtgtgtccaacacattccacatctgctttaattttcggtatgttcgggtcgttcgtttcccaacagatatgcaatataagtcatcattat |
229 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24983978 |
atatgtttgcgtgtgtccaacacattccgcatccgctttaattttcggtattttcgggtcgttcgtttcccaacagatatgcaatataagtcatcattat |
24984077 |
T |
|
| Q |
230 |
tgtttcatttttagttttcgcactatataaagggtgctcggatctcattttaactcacaccaaaactcaaagcattatagagttttctctcttctccct |
328 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24984078 |
tgtttcatttttagttttcgcactatataaagggtgctcggatctcatcttaactcacaccaaaactcaaagcattatagagttttctctcttctccct |
24984176 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 283 - 330
Target Start/End: Complemental strand, 10572698 - 10572651
Alignment:
| Q |
283 |
ctcacaccaaaactcaaagcattatagagttttctctcttctccctat |
330 |
Q |
| |
|
||||||||||||||| ||| ||| | |||||||||||||||||||||| |
|
|
| T |
10572698 |
ctcacaccaaaactcgaagaatttttgagttttctctcttctccctat |
10572651 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University