View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1271_high_98 (Length: 318)
Name: NF1271_high_98
Description: NF1271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1271_high_98 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 168; Significance: 5e-90; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 168; E-Value: 5e-90
Query Start/End: Original strand, 87 - 283
Target Start/End: Original strand, 41222087 - 41222293
Alignment:
| Q |
87 |
caaacctgccacgtacgcgtggtcgattgtctgctagtgtctttcgacatgcatactataaaaacaacacattcagactcttctctttctaatcaaactt |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41222087 |
caaacctgccacgtacgcgtggtcgattgtctgctagtgtctttcgacatgcatactataaaaacaacacattcagactcttctctttctaatcaaactt |
41222186 |
T |
 |
| Q |
187 |
tgttaat----------tatagtatagtataaattctctaatgatcttgattaccttaatggtcttgttaaagttcctctgtgttctcttagctctgtac |
276 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
41222187 |
tgttaattatagtatagtatagtatagtataaattctctaatgatcttgattaccttaatggtcttgttgaagttcctctgtgttctcttagctctgtac |
41222286 |
T |
 |
| Q |
277 |
ttggaaa |
283 |
Q |
| |
|
||||||| |
|
|
| T |
41222287 |
ttggaaa |
41222293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 92 - 143
Target Start/End: Complemental strand, 2637104 - 2637053
Alignment:
| Q |
92 |
ctgccacgtacgcgtggtcgattgtctgctagtgtctttcgacatgcatact |
143 |
Q |
| |
|
|||||||||| ||||| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
2637104 |
ctgccacgtatgcgtgttcgattgtctgctagtgtctttcggcatgcatact |
2637053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University