View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1271_low_103 (Length: 348)
Name: NF1271_low_103
Description: NF1271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1271_low_103 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 91; Significance: 5e-44; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 91; E-Value: 5e-44
Query Start/End: Original strand, 103 - 193
Target Start/End: Complemental strand, 4240397 - 4240307
Alignment:
| Q |
103 |
atagcttattaccaatatattctccatactttgcttttttctctttttatcatgacacttatactaaactgtgtgtttgaatgaaagaaag |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4240397 |
atagcttattaccaatatattctccatactttgcttttttctctttttatcatgacacttatactaaactgtgtgtttgaatgaaagaaag |
4240307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 204 - 256
Target Start/End: Complemental strand, 4240135 - 4240083
Alignment:
| Q |
204 |
tataccagaaaacaccaaaacagacactgacagagcaagctataatccatgtt |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4240135 |
tataccagaaaacaccaaaacagacactgacagagcaagctataatccatgtt |
4240083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 146 - 188
Target Start/End: Complemental strand, 19923531 - 19923489
Alignment:
| Q |
146 |
tttttatcatgacacttatactaaactgtgtgtttgaatgaaa |
188 |
Q |
| |
|
||||||| ||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
19923531 |
tttttatgatgacacttttactaaactgtttgtttgaatgaaa |
19923489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University