View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1271_low_120 (Length: 325)
Name: NF1271_low_120
Description: NF1271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1271_low_120 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 143; Significance: 4e-75; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 143; E-Value: 4e-75
Query Start/End: Original strand, 145 - 307
Target Start/End: Original strand, 26955257 - 26955419
Alignment:
| Q |
145 |
cgacactccaatcttgcaaggggcgtgtttgatcagctggtagtgcataattctttcactatttattatcataattatcacacggttattttgtagtgat |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| || |
|
|
| T |
26955257 |
cgacactccaatcttgcaaggggcgtgtttgatcagctggtagtgcataattctttcactatttattatcataattatcacacggttatattgtagtaat |
26955356 |
T |
 |
| Q |
245 |
taagaactattaagagcttcgatctatgagttctctcaccaagttatatattcttcgacatcc |
307 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
26955357 |
taagagctattaagagcttcgatctatgagttctctcaccaagttatatattattcaacatcc |
26955419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University