View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1271_low_122 (Length: 321)
Name: NF1271_low_122
Description: NF1271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1271_low_122 |
 | |
|
| [»] scaffold0790 (1 HSPs) |
| | |
|
Alignment Details
Target: chr4 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 98 - 294
Target Start/End: Original strand, 2299334 - 2299530
Alignment:
| Q |
98 |
cagtggcgattacctacagttgctcatagtactggtatacttcttgcatttttgtttttaggttgttcatctagcctttgtcgtgcttcactttttcttt |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||| |
|
|
| T |
2299334 |
cagtggcgattacctacagttgctcatagtaatggtatacttcttgcatttttgtttttaggttgttcatctggcctttgtcgcgcttcactttttcttt |
2299433 |
T |
|
| Q |
198 |
ggagtaatctggtttagttccgctcagctgtagcaggctttcatgcaactttgcctctgttgtgcggtgtttcaatcgtctgctgcatcagtttgtt |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2299434 |
ggagtaatctggtttagttccgctcagctgtagcaggctttcatgcaactttgcttctgttgtgcggtgtttctatcgtctgctgcatcagtttgtt |
2299530 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0790 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: scaffold0790
Description:
Target: scaffold0790; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 189 - 285
Target Start/End: Original strand, 3449 - 3545
Alignment:
| Q |
189 |
tttttctttggagtaatctggtttagttccgctcagctgtagcaggctttcatgcaactttgcctctgttgtgcggtgtttcaatcgtctgctgcat |
285 |
Q |
| |
|
|||| |||||||||||| |||||| |||| |||||||||||| ||||||||||||| ||||| |||||| ||| ||||||| |||||||||||||| |
|
|
| T |
3449 |
ttttgctttggagtaatatggttttgttcagctcagctgtagtaggctttcatgcagttttgcttctgttctgcagtgtttcgatcgtctgctgcat |
3545 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 189 - 285
Target Start/End: Original strand, 38684349 - 38684445
Alignment:
| Q |
189 |
tttttctttggagtaatctggtttagttccgctcagctgtagcaggctttcatgcaactttgcctctgttgtgcggtgtttcaatcgtctgctgcat |
285 |
Q |
| |
|
|||| |||||||||||| |||||| |||| |||||||| ||| || |||||||||| ||||| ||||||||| ||||||| |||||||||||||| |
|
|
| T |
38684349 |
ttttgctttggagtaatatggttttgttcagctcagctatagtagactttcatgcagttttgcttctgttgtgtagtgtttctatcgtctgctgcat |
38684445 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University