View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1271_low_127 (Length: 313)
Name: NF1271_low_127
Description: NF1271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1271_low_127 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 72; Significance: 9e-33; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 72; E-Value: 9e-33
Query Start/End: Original strand, 95 - 170
Target Start/End: Complemental strand, 51253154 - 51253079
Alignment:
| Q |
95 |
gaaaagaagcgttattgtagctgctagacagttgtttttatgagaagagcattgtacccagaaaatggtgagaacc |
170 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
51253154 |
gaaaagaagcgttattgtagctgctagacagttgtttttatgagaagagcattgtacccagaaaatggtgacaacc |
51253079 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 182 - 213
Target Start/End: Complemental strand, 51253026 - 51252995
Alignment:
| Q |
182 |
ataaaatataatcatatatgttggtgtcggaa |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
51253026 |
ataaaatataatcatatatgttggtgtcggaa |
51252995 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University