View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1271_low_127 (Length: 313)

Name: NF1271_low_127
Description: NF1271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1271_low_127
NF1271_low_127
[»] chr1 (2 HSPs)
chr1 (95-170)||(51253079-51253154)
chr1 (182-213)||(51252995-51253026)


Alignment Details
Target: chr1 (Bit Score: 72; Significance: 9e-33; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 72; E-Value: 9e-33
Query Start/End: Original strand, 95 - 170
Target Start/End: Complemental strand, 51253154 - 51253079
Alignment:
95 gaaaagaagcgttattgtagctgctagacagttgtttttatgagaagagcattgtacccagaaaatggtgagaacc 170  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
51253154 gaaaagaagcgttattgtagctgctagacagttgtttttatgagaagagcattgtacccagaaaatggtgacaacc 51253079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 182 - 213
Target Start/End: Complemental strand, 51253026 - 51252995
Alignment:
182 ataaaatataatcatatatgttggtgtcggaa 213  Q
    ||||||||||||||||||||||||||||||||    
51253026 ataaaatataatcatatatgttggtgtcggaa 51252995  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University