View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1271_low_130 (Length: 306)
Name: NF1271_low_130
Description: NF1271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1271_low_130 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 30 - 72
Target Start/End: Original strand, 9426144 - 9426186
Alignment:
| Q |
30 |
gtttattgttgttgttgaagtctatgatgattttaaacagctc |
72 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9426144 |
gtttattgttgttgttgaagtctatgatgattttaaacagctc |
9426186 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 248 - 280
Target Start/End: Original strand, 9426360 - 9426392
Alignment:
| Q |
248 |
cacagacaaagtacttttactatcctttaatgc |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
9426360 |
cacagacaaagtacttttactatcctttaatgc |
9426392 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University