View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1271_low_137 (Length: 289)
Name: NF1271_low_137
Description: NF1271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1271_low_137 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 260
Target Start/End: Complemental strand, 33835516 - 33835256
Alignment:
| Q |
1 |
ttttacatagttactaagttgttaatgaatcgaactctgactcttcttcttcctctcccttcgagcttccacttctgacttgatagaaggttgaggaata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
33835516 |
ttttacatagttactaagttgttaatgaatcgaactctgactcttcttcttcctctccctccgagcttccacttctaacttgatagaaggttgaggaata |
33835417 |
T |
 |
| Q |
101 |
tctcaaccaaggtatctttatgacctccccatagtctgtgattggttagcgcccgttaaggatagaccttcttgctttagaatatcccccatcctacgac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33835416 |
tctcaaccaaggtatctttatgacctccccatagtctgtgattggttagcgcccgttaaggatagaccttcttgctttagaatatcccccatcctacgac |
33835317 |
T |
 |
| Q |
201 |
taatgatgtgagat-gctaactcaactagaaactnnnnnnnccgatcaatgaagactagag |
260 |
Q |
| |
|
|||| ||||||||| ||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
33835316 |
taattatgtgagatggctaactcaactagaaactaaaaaaaccgatcaatgaagactagag |
33835256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University