View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1271_low_165 (Length: 261)
Name: NF1271_low_165
Description: NF1271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1271_low_165 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 11 - 233
Target Start/End: Complemental strand, 43537189 - 43536970
Alignment:
| Q |
11 |
agaatatcaaggagggcatcccccggtggaagaaatacacacataaggaaggcgaggagtgtccagacttctttgaaggttgatttggatcatgaggtta |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
43537189 |
agaaaatcaaggagggcatcccccggtggaagaaatacacacataaggaaggcgaggagtgtccagacttctttgaaggttgatttggat---gaggtta |
43537093 |
T |
 |
| Q |
111 |
atagtggtgctgctcttagtagagcttcaagtttgggactctcattttcctttactggattctctgttcctcttgatgaaatctctaactccaaaccctt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43537092 |
atagtggtgctgctcttagtagagcttcaagtttgggactctcattttcctttactggattctctgttcctcttgatgaaatctctaactccaaaccctt |
43536993 |
T |
 |
| Q |
211 |
cagtgatgaagatatccgtaagt |
233 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
43536992 |
cagtgatgaagatatccgtaagt |
43536970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University