View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1271_low_174 (Length: 253)
Name: NF1271_low_174
Description: NF1271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1271_low_174 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 217; Significance: 1e-119; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 17 - 245
Target Start/End: Original strand, 37990209 - 37990437
Alignment:
| Q |
17 |
attggggagtaattcgtttgcttttgatatttccaaagttgggttatcgaaggatttgaataagttggatataaggcacaataaaatctatggtaagcta |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
37990209 |
attggggagtaattcgtttgcttttgatatttcgaaagttgggttatcgaaggatttgaataagttggatataaggcacaataaaatatatggtaagcta |
37990308 |
T |
|
| Q |
117 |
ccagagagactctcggagctcaggtatctgcataagttgaacgtgagcgataataatttgtgtggtcagattccaatgaacacaaggtttgatgcgagtt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37990309 |
ccagagagactctcggagctcaggtatctgcataagttgaacgtgagcgataataatttgtgtggtcagattccaatgaacacaaggtttgatgcgagtt |
37990408 |
T |
|
| Q |
217 |
gttatgttcttaataagtgcttctgtggt |
245 |
Q |
| |
|
|||||||||||||||||||||| |||||| |
|
|
| T |
37990409 |
gttatgttcttaataagtgcttgtgtggt |
37990437 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 27 - 136
Target Start/End: Original strand, 37994403 - 37994512
Alignment:
| Q |
27 |
aattcgtttgcttttgatatttccaaagttgggttatcgaaggatttgaataagttggatataaggcacaataaaatctatggtaagctaccagagagac |
126 |
Q |
| |
|
||||| |||||||||||| || ||||||| ||| ||||| ||||| |||||||||| | ||| |||||||||||||||||| ||||| ||| ||| |
|
|
| T |
37994403 |
aattcatttgcttttgattttgggaaagttgagttgccgaagaatttgggtaagttggatttgaggaacaataaaatctatggtacactaccggagggac |
37994502 |
T |
|
| Q |
127 |
tctcggagct |
136 |
Q |
| |
|
| ||||||| |
|
|
| T |
37994503 |
taacggagct |
37994512 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University