View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1271_low_179 (Length: 252)
Name: NF1271_low_179
Description: NF1271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1271_low_179 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 33835715 - 33835955
Alignment:
| Q |
1 |
attttagttgagaaatcataaattatcgttagggtaattcgttcgaggagcttaataactcacttagtcgttggcgagtgagacaaatgtagcttgtcaa |
100 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
33835715 |
attttagctgagaaatcataaattatcgttagggtaattcattcgaggagcttaataactcacttagtcgttggtgagtgagacaaatgtagcttgtcaa |
33835814 |
T |
|
| Q |
101 |
ctagtttgcatcataaagtgtaggtaattaatcatttgcatcacttataaatttcattggtctataaataccatttgtaaatttcactatagataaaatt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
33835815 |
ctagtttgcatcataaagtgtaggtaattaatcatttgcatcacttataaatttcattggtctataaataccatttgtaaatttcactataaataaaatt |
33835914 |
T |
|
| Q |
201 |
tagtcaatcaaacaacttattttacttgcaatttcacctatg |
242 |
Q |
| |
|
||||||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
33835915 |
tagtcaatcaaacaacttattttacctgc-atttcacctatg |
33835955 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University