View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1271_low_185 (Length: 251)
Name: NF1271_low_185
Description: NF1271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1271_low_185 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 45 - 205
Target Start/End: Complemental strand, 35802051 - 35801891
Alignment:
| Q |
45 |
aaatggactgctactattttggtttggaaatatgaactttactcttaaccattccattatattttacctatgctgaaggttaagtatagatgtttcaaaa |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35802051 |
aaatggactgctactattttggtttggaaatatgaactttactcttaaccattccattatattttacctatgctgaaggttaagtatagatgtttcaaaa |
35801952 |
T |
 |
| Q |
145 |
tgtcaatcatatcctaaaacgtggcaaaacaaacacaatgttgacagaattttcaacatag |
205 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35801951 |
tgtcaatcatatactaaaacgtgacaaaacaaacacaatgttgacagaattttcaacatag |
35801891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University