View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1271_low_190 (Length: 251)
Name: NF1271_low_190
Description: NF1271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1271_low_190 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 18 - 242
Target Start/End: Original strand, 15760314 - 15760541
Alignment:
| Q |
18 |
tatctcaaacacatctataaagattaaaaa-tgttgatcgtttagtgattaaagatattaaatttatcgatcaaagatattaaaatttataacaatattt |
116 |
Q |
| |
|
|||||||||||||||||||||||| ||||| ||||||| ||||||||||||||||||||||||||| ||||||||||||||||||| || ||||| ||| |
|
|
| T |
15760314 |
tatctcaaacacatctataaagataaaaaaatgttgattgtttagtgattaaagatattaaatttagtgatcaaagatattaaaattgattacaatgttt |
15760413 |
T |
 |
| Q |
117 |
ttaggtttttcaatt---gtagatgggaaaataaaaggtcaaacacacttgactagatccacgtacccgtcacagcctacacgtagacggactataacat |
213 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15760414 |
ttaggtttttcaattattgtagatgggcaaataaa-ggtcaaacacacttgactagatccacgtacccgtcacagcctacacgtagacggactataacat |
15760512 |
T |
 |
| Q |
214 |
ggagtcgccttagttcgcaccagtataat |
242 |
Q |
| |
|
||| ||||| |||| |||||||| ||||| |
|
|
| T |
15760513 |
ggactcgccctagtccgcaccagaataat |
15760541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University