View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1271_low_193 (Length: 251)
Name: NF1271_low_193
Description: NF1271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1271_low_193 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 188 - 223
Target Start/End: Complemental strand, 41483103 - 41483068
Alignment:
| Q |
188 |
tgttaatcgttgatttgaattttcaatctagtaatt |
223 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| |
|
|
| T |
41483103 |
tgttaatcgttgatttgaattttcaatccagtaatt |
41483068 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 142 - 223
Target Start/End: Original strand, 53328954 - 53329036
Alignment:
| Q |
142 |
gcacttgtgctctagcattaacaatggttt-ttgcttctctatgagatgttaatcgttgatttgaattttcaatctagtaatt |
223 |
Q |
| |
|
||||||| |||||||||||||| ||| || |||||| || ||| |||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
53328954 |
gcacttgagctctagcattaacgatgattaattgctttgataagagttgttaaacgttgatttgaattttcaatccagtaatt |
53329036 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University