View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1271_low_195 (Length: 251)
Name: NF1271_low_195
Description: NF1271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1271_low_195 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 6 - 247
Target Start/End: Original strand, 42468031 - 42468272
Alignment:
| Q |
6 |
agcaccacagataacatgtatctatctataaaatcttaattttagtacctttggtttcttcctgttagccttaataaactgtgaaactttacatgagaca |
105 |
Q |
| |
|
||||| |||||||||||||||||||| ||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42468031 |
agcactacagataacatgtatctatcaataaaatcttaattttagtacctttagtttcttcttgttagccttaataaactgtgaaactttacatgagaca |
42468130 |
T |
 |
| Q |
106 |
gaaccattatacagtccagtaggcatcttaacatccacaacagcatcgtcatcaaaatcatcatatattgcaaactggctgtgaaaaatttgtaaattgc |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
42468131 |
gaaccattatacagtccagtaggcatcttaacatccacaacagcatcgtcatcaaaatcatcatatgttgcaaactggctgtgaaaaatttgtaaattgc |
42468230 |
T |
 |
| Q |
206 |
cagtaagctcccaaacgttgtaaacaagtaagatagaagata |
247 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
42468231 |
cagtaagctctcaaacgttgtaaacaagtaagatagaagata |
42468272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University