View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1271_low_196 (Length: 251)
Name: NF1271_low_196
Description: NF1271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1271_low_196 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 129; Significance: 7e-67; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 65 - 213
Target Start/End: Original strand, 42468456 - 42468604
Alignment:
| Q |
65 |
tggtttggtcaaaataaacaagagtaaagacatacccattagctggtgtaaaacgctttagagaattactaggcttaggagcaatgtgactgtaaaagcc |
164 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
42468456 |
tggtttggtgaaaataaacaagagtaaagacatacccattagttggtgtaaaacgcttaagagaattactgggcttaggagcaatgtgactgtaaaagcc |
42468555 |
T |
|
| Q |
165 |
ctgcaaaccaatgtgatgatccttctgccatgttaacgtggttcaacaa |
213 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
42468556 |
ctgcaaaccaatgtgatgatccttcagccatgttaacgtggttcaacaa |
42468604 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 96 - 158
Target Start/End: Complemental strand, 34223351 - 34223289
Alignment:
| Q |
96 |
atacccattagctggtgtaaaacgctttagagaattactaggcttaggagcaatgtgactgta |
158 |
Q |
| |
|
|||||||||||||||| | |||||||| |||||||||||||||| |||||||| |||||||| |
|
|
| T |
34223351 |
atacccattagctggtctcgaacgcttttgagaattactaggctttggagcaatttgactgta |
34223289 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University