View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1271_low_203 (Length: 244)
Name: NF1271_low_203
Description: NF1271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1271_low_203 |
 | |
|
| [»] scaffold0643 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0643 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: scaffold0643
Description:
Target: scaffold0643; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 1 - 143
Target Start/End: Original strand, 8075 - 8217
Alignment:
| Q |
1 |
ttatctctgtcgtggactgtgctgtttgtgcggtttgtcctagttgctaaggtgctatgtggtactgcttgttttcttttcttcacctatggtgtcccct |
100 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
8075 |
ttatctctgtcgtggactgtgttgtttgtgcggtttgtcctagttgctaaggcgctctgtggtactgcttgttttcttttcttcacctgtggtgtcccct |
8174 |
T |
|
| Q |
101 |
tccttcgttgatacaaggaggggctgtttgctcactagcttat |
143 |
Q |
| |
|
|| |||| ||||||||||||||||||||||||| ||||||||| |
|
|
| T |
8175 |
tctttcgctgatacaaggaggggctgtttgctcgctagcttat |
8217 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 77 - 129
Target Start/End: Complemental strand, 30014132 - 30014080
Alignment:
| Q |
77 |
ttttcttcacctatggtgtccccttccttcgttgatacaaggaggggctgttt |
129 |
Q |
| |
|
|||||||||||| ||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
30014132 |
ttttcttcacctgtggtgtccccttctttcgctgatacaaggaggggctgttt |
30014080 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 30014209 - 30014166
Alignment:
| Q |
1 |
ttatctctgtcgtggactgtgctgtttgtgcggtttgtcctagt |
44 |
Q |
| |
|
|||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
30014209 |
ttatctctatcgtggactgtgttgtttgtgcggtttgtcctagt |
30014166 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University