View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1271_low_210 (Length: 237)
Name: NF1271_low_210
Description: NF1271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1271_low_210 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 95 - 217
Target Start/End: Original strand, 33384887 - 33385009
Alignment:
| Q |
95 |
attttcccattgtatgcagctggattattgacttcatttctgttgaagttgaaaaatgatggatttcaacatgattcatcttgggagaacatgaaatctt |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33384887 |
attttcccattgtatgcagctggattattgacttcatttctgttgaagttgaaaaatgatggatttcaacatgattcatcttgggagaacatgaaatctt |
33384986 |
T |
|
| Q |
195 |
atggcggttttgtactggatggc |
217 |
Q |
| |
|
|||||||||| ||| |||||||| |
|
|
| T |
33384987 |
atggcggtttggtattggatggc |
33385009 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University