View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1271_low_211 (Length: 236)

Name: NF1271_low_211
Description: NF1271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1271_low_211
NF1271_low_211
[»] chr3 (1 HSPs)
chr3 (36-224)||(114309-114491)


Alignment Details
Target: chr3 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 36 - 224
Target Start/End: Original strand, 114309 - 114491
Alignment:
36 tggaaatttcaaatagtttaccaaactttcaagatcatcaattacctcctaaaataagcaatagtagtagatatgatgaaatatgtttaaaagaaagatt 135  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
114309 tggaaatttcaaatagtttaccaaactttcaagatcatcaattacctcctaaaataagcaatagtagtagatatgatgaaatatgtttaaaagaaagatt 114408  T
136 aatgtcagaattattaggcaatgagggaggaataattaggagacaccaacgtacatattccgatagcatgctatctgagcagcaacagc 224  Q
    |||||||||   ||||||||||||||||||||||   ||||||||||||||||||||||||||||||||||||||||||||||||||||    
114409 aatgtcaga---attaggcaatgagggaggaata---aggagacaccaacgtacatattccgatagcatgctatctgagcagcaacagc 114491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University