View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1271_low_215 (Length: 228)
Name: NF1271_low_215
Description: NF1271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1271_low_215 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 119; Significance: 6e-61; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 7 - 140
Target Start/End: Complemental strand, 32501836 - 32501702
Alignment:
| Q |
7 |
aaaatatctttaatccataaattatagtataataaattttttataat-atgccctttgtgtctaaaataaaactctttattttacgaatattttttcaaa |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32501836 |
aaaatatctttaatccataaattatagtataataatttttttataattatgtcctttgtgtctaaaataaaactctttattttacgaatattttttcaaa |
32501737 |
T |
 |
| Q |
106 |
aatgagagaacaaaagagtgtgatgttttttcttg |
140 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
32501736 |
aatgagagaacaaaagagtgtgatgttttttcttg |
32501702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 166 - 228
Target Start/End: Complemental strand, 32501487 - 32501425
Alignment:
| Q |
166 |
atattataatatactgcttgttcaaataaagacagctttttcctgatcatgatgaagttccca |
228 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
32501487 |
atattataatatactgcttgtttaaataaagacagctttttcctaatcatgatgaagttccca |
32501425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 178 - 224
Target Start/End: Complemental strand, 32493320 - 32493272
Alignment:
| Q |
178 |
actgcttgttcaaataaagaca--gctttttcctgatcatgatgaagtt |
224 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
32493320 |
actgcttgttcaaataaagacaaagctttttcctgatcatgatgaagtt |
32493272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University