View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1271_low_228 (Length: 203)

Name: NF1271_low_228
Description: NF1271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1271_low_228
NF1271_low_228
[»] chr8 (1 HSPs)
chr8 (1-100)||(10414080-10414179)


Alignment Details
Target: chr8 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 1 - 100
Target Start/End: Original strand, 10414080 - 10414179
Alignment:
1 tattcaacacaccatggcttctttttaggttcatagatgagtttcctaatacacttgaacctgtttcaaatgaaataatccatatattaataatctttgt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10414080 tattcaacacaccatggcttctttttaggttcatagatgagtttcctaatacacttgaacctgtttcaaatgaaataatccatatattaataatctttgt 10414179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University