View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1271_low_52 (Length: 452)
Name: NF1271_low_52
Description: NF1271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1271_low_52 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 147; Significance: 2e-77; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 145 - 307
Target Start/End: Original strand, 26955257 - 26955419
Alignment:
| Q |
145 |
cgacactccaatcttgcaaggggcgtgtttgatcagctggtagtgcataattctttcactatttattatcataattatcacacggttattttgtagtgat |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| || |
|
|
| T |
26955257 |
cgacactccaatcttgcaaggggcgtgtttgatcagctggtagtgcataattctttcactatttattatcataattatcacacggttatattgtagtaat |
26955356 |
T |
|
| Q |
245 |
taagaactattaagagcttcgatctatgagttctctcaccaagttatatattattcgacatcc |
307 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
26955357 |
taagagctattaagagcttcgatctatgagttctctcaccaagttatatattattcaacatcc |
26955419 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 39; Significance: 0.0000000000007; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 386 - 452
Target Start/End: Complemental strand, 14960268 - 14960202
Alignment:
| Q |
386 |
gctgaataaatctacacagaccactattgatacaataaccacttaatctgcaaaccaccacagtaac |
452 |
Q |
| |
|
|||||||||| ||||| ||||||||||||| |||||||||||| |||||||||| || |||||||| |
|
|
| T |
14960268 |
gctgaataaagctacaaagaccactattgaaacaataaccactgtatctgcaaacaacaacagtaac |
14960202 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University