View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1271_low_54 (Length: 451)
Name: NF1271_low_54
Description: NF1271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1271_low_54 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 256; Significance: 1e-142; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 137 - 440
Target Start/End: Complemental strand, 49862370 - 49862076
Alignment:
| Q |
137 |
gtcatcaatcaactcactgagtctcctccctttcacctcattctgcatctgcggcacaatccaacgacggagaaatgcttggtttcctctctctgctaag |
236 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49862370 |
gtcatcaatcaactcaccgagtctcctccctttcacctcgttctgca---------caatccaacgacggagaaatgcttggtttcctctctctgctaag |
49862280 |
T |
 |
| Q |
237 |
gattctcgtgaacgacaaaacacgactcattggtgaccgaaacgatgatggtgaatcacaactcgactctcccacagcaaaactcttgcaatcggattca |
336 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49862279 |
gattctcgtgaacgacaaaacacgactcattggtgaccgaaacgatgatggtgaatcacaactcgactctcccacagcaaaactcttgcaatcggattca |
49862180 |
T |
 |
| Q |
337 |
ctccttctcggaatctcaacggtaatgtcaaccaatgaagattgcttctcatcagaacatgaggaagaacaagaagaagaaaattccgatacagactggt |
436 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
49862179 |
ctccttctcggaatctcaacggtaatgtcaaccgatgaagattgcttctcatcagaacatgaggaagaacaagaagaagaaaattccgatacagaccggt |
49862080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 36 - 101
Target Start/End: Complemental strand, 49862436 - 49862371
Alignment:
| Q |
36 |
gcaaatgatgatggtcatccctcgccgttcactttataatttgtgttgcgacattcatgcacttaa |
101 |
Q |
| |
|
|||||||||||| |||||||||| ||||| || || ||||||||||||| |||||||||||||||| |
|
|
| T |
49862436 |
gcaaatgatgatcgtcatccctccccgttgacattgtaatttgtgttgcaacattcatgcacttaa |
49862371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University