View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1271_low_70 (Length: 416)
Name: NF1271_low_70
Description: NF1271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1271_low_70 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 29 - 408
Target Start/End: Original strand, 24604820 - 24605200
Alignment:
| Q |
29 |
aaatacttcataaaatatcatagttttaaaaattcttccaatttatgatataaacaatagagttgaattactttctaaaattacactgcctcataaaata |
128 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||| | ||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
24604820 |
aaatacttcataaaatatcatcgttttaaaaattcttccaatttctaatataaacaatagagttgaattattttctaaaattacactgcctcataaaatt |
24604919 |
T |
 |
| Q |
129 |
ttatcatccaaacatattcgcaaacttaatttannnnnnnnnnnnnnnnnn-catagattctctccaccttaaataatcttattcgaaggaccgttagac |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || | |||||||||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
24604920 |
ttatcatccaaacatattcgcaaacttaatttaatttttttttgaattttttcacatattctctccaccataaataatcttattcgaaggactgttagac |
24605019 |
T |
 |
| Q |
228 |
actaaatataaacatctttcacgaattccaacctacactagtctttttattcacacactctagtaaatgaacttttcattgtgtgcatgtaacaaaagta |
327 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||| ||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24605020 |
actaaatatagacatctttcacgaattccaacctacaccagtctttttcttcacacaatctagtaaatgaacttttcattgtgtgcatgtaacaaaagta |
24605119 |
T |
 |
| Q |
328 |
aaaaagaccatcgaatttatttttgaaatttgaaatcgagacaagaagccataatgggcatgtatgtgttttgtctctgct |
408 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24605120 |
aaaaagaccatcgaatttatttttgaaatttgaaatcgagacaagaagccataatgggcatgtatgtgttttgtctctgct |
24605200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University