View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1271_low_74 (Length: 400)
Name: NF1271_low_74
Description: NF1271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1271_low_74 |
 |  |
|
| [»] scaffold0130 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0130 (Bit Score: 133; Significance: 5e-69; HSPs: 1)
Name: scaffold0130
Description:
Target: scaffold0130; HSP #1
Raw Score: 133; E-Value: 5e-69
Query Start/End: Original strand, 25 - 181
Target Start/End: Original strand, 24514 - 24670
Alignment:
| Q |
25 |
tagtaatgcttaacatagcgaaatattgtttcacgacaggttcacaaaacatgcaaatcactactttgagaccaaactaataccactttttaatcacctg |
124 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||| ||||||||| |||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24514 |
tagtaatgcttaacatcgcgaaatattgtttcacgacaggttcacgaaacatgcatatcattactttgagaccaaactaataccactttttaatcacctg |
24613 |
T |
 |
| Q |
125 |
atacaataaaagggtcctactactctctatcataatgggaaaaacgattggaaataa |
181 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
24614 |
atgcaataaaagggtcctactactctctatcataatgggaaaaacgattgaaaataa |
24670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 314 - 396
Target Start/End: Original strand, 47799995 - 47800077
Alignment:
| Q |
314 |
attttacattttgaaatatatgatgcacttctaatattgctactattgtaggttaaataaatctgtgcaaattcatctcactc |
396 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||| ||||| |||||| | || || || ||||||||||| ||||||| |
|
|
| T |
47799995 |
attttacattttgaagtatatgatgcacttctaatattactactgctgtaggctcaaaaattcagtgcaaattcaactcactc |
47800077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 219 - 269
Target Start/End: Original strand, 47799910 - 47799960
Alignment:
| Q |
219 |
attgcacttgatggcaattatattggttatagacaaaattaaatgaggtga |
269 |
Q |
| |
|
||||||||||| ||||| ||||||||||||||| ||| ||||||||||||| |
|
|
| T |
47799910 |
attgcacttgaaggcaactatattggttatagataaagttaaatgaggtga |
47799960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 49 - 140
Target Start/End: Complemental strand, 13796465 - 13796375
Alignment:
| Q |
49 |
attgtttcacgacaggttcacaaaacatgcaaatcactactttgagaccaaactaata-ccactttttaatcacctgatacaataaaagggtc |
140 |
Q |
| |
|
|||||||||||| |||||||| | |||||| || |||||||||| |||||||||||| || |||||||||| | |||| ||| |||| |||| |
|
|
| T |
13796465 |
attgtttcacgataggttcacga--catgcatataactactttgacaccaaactaataccctctttttaatcgcatgatgcaacaaaatggtc |
13796375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University