View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1271_low_81 (Length: 395)
Name: NF1271_low_81
Description: NF1271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1271_low_81 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 302; Significance: 1e-170; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 29 - 382
Target Start/End: Complemental strand, 3090443 - 3090088
Alignment:
| Q |
29 |
aattttaaggtttaaattgaatattaaaatgaagtttttctgtacaaaaaagaagttgtcactcaaatagtcaaatttgatcttgcaacctagtcaagaa |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3090443 |
aattttaaggtttaaattgaatattaaaatgaagtttttctgtacaaaaaagaagttgtcactcaaatagtcaaatttgatcttgcaacctagtcaagaa |
3090344 |
T |
|
| Q |
129 |
gagatagttgctggaccagttgagctacattgtcatcgtatagaattttcaactttcatatttaatatttgtaaaataaaattcgtttgaaggcctaaaa |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||| |||||||||| |
|
|
| T |
3090343 |
gagatagttgctggaccagttgagctacattgtcatcgtatagaattttcaactttcatatttaatatttgtacagtaaaattcgtttggaggcctaaaa |
3090244 |
T |
|
| Q |
229 |
gatctttagaatttggaccgtcttatgcttggatcgaccctagatataaatataatataaccatgctactttgcttcttctttttttctcattaa--nnn |
326 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3090243 |
gatctttagaatttggaccgtcttatgtttggatcgaccctagatataaatataatataaccatgctactttgcttcttctttttttctcattaattttt |
3090144 |
T |
|
| Q |
327 |
nnnnnngagagatttttctcattaattataagtaggatatttcgaagtggttccct |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3090143 |
ttttttgagagatttttctcattaattataagtaggatatttcgaagtggttccct |
3090088 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University