View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1271_low_85 (Length: 390)
Name: NF1271_low_85
Description: NF1271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1271_low_85 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 311; Significance: 1e-175; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 311; E-Value: 1e-175
Query Start/End: Original strand, 30 - 368
Target Start/End: Original strand, 33335989 - 33336327
Alignment:
| Q |
30 |
gaacctcctcacaattatcctatgttgatccagcagttttctagaatttgcacattctttttggtggaattgtgacatatttagccgtcatagtcggttt |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33335989 |
gaacctcctcacaattatcctatgttgatccagcagttttctagaatttgcacattctttttggtggaattgtgacatatttagccgtcatagtcggttt |
33336088 |
T |
|
| Q |
130 |
cttctccttatcatcttttgtctttcgatcttgctgcacaaaagaatgcaacttattgcaatgatgaacaaaatgaccaattgtttgccaattgttataa |
229 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
33336089 |
cttctccttatcatcttttgtttttcgatcttgctacacaaaagaatgcaacttattgcaatgatgaacaaaatgatcaattgtttggcaattgttataa |
33336188 |
T |
|
| Q |
230 |
taatcaagtaatctatcataaacaatctccacataaaaagcaaaatcttctctttctaccaagatttcatcaaagatgcgttttgataggtcaagatctc |
329 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33336189 |
taatcaagtaatctatcataaacaatctccacataaaaagcaaaatcttctctttctaccaagatttcatcaaagatgcgttttgataggtcaagatcta |
33336288 |
T |
|
| Q |
330 |
catgaaccctagcatagtgtccgaaaacatggttctgtg |
368 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
33336289 |
catgaaccctagcatagtgtccgaaagcatggttatgtg |
33336327 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University