View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1271_low_95 (Length: 368)
Name: NF1271_low_95
Description: NF1271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1271_low_95 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 314; Significance: 1e-177; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 314; E-Value: 1e-177
Query Start/End: Original strand, 7 - 356
Target Start/End: Complemental strand, 279433 - 279084
Alignment:
| Q |
7 |
atgaccactcgggagagtttcctaatttttgatgtagttgcttcatataaatatttgtttgtgcttccgtctttgcagtgttgtaaacttctttgttgca |
106 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
279433 |
atgaccactcgggcgagtttcctaatttttgatctagttgcttcatataaatatttgtttgtgcttcagtctttgcagtgttgtaaacttctttgttgca |
279334 |
T |
|
| Q |
107 |
gtcttggagaagggacattgaccaagcagaaacataatactttccatcttgttgtaaatcaacttcagcatctttagaggtatgtgaattactcaaaaaa |
206 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
279333 |
gtcttggagaagggacattgaccaagcaggaacataatactttccatcttgttgtaaatcaacttcagcatctttagaggtatgtgaattactcaaaaaa |
279234 |
T |
|
| Q |
207 |
caaattttttgtccagtgtccttatttgtataagtagtcatccataaataatctccatgactctcccaagtagcagtgccattggtacgaaccttctctc |
306 |
Q |
| |
|
|||| ||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
279233 |
caaaatttttgtccagtgcccttatttgtataagtagtcatccataaagaatctccatgactctcccaagtagcagtgccattggtgagaaccttctctc |
279134 |
T |
|
| Q |
307 |
ctaactttatggcagcatggagtcttttaagatgtccatattttggttca |
356 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
279133 |
ctaactttatggcagcatggagtcttttaagatgtccatattttggttca |
279084 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University