View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1271_low_97 (Length: 367)
Name: NF1271_low_97
Description: NF1271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1271_low_97 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 13 - 340
Target Start/End: Original strand, 7461837 - 7462171
Alignment:
| Q |
13 |
aatattaaattatatgtattttatgtatgtacttcttcattttacaaaccatatatactttaatctacaatggacatcaannnnnnnncttttatgaggg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
7461837 |
aatattaaattatatgtattttatgtatgtacttcttcattttacaaaccatatatactttaatctacaatggacatcaattttttttcttttatgaggg |
7461936 |
T |
|
| Q |
113 |
agtgcttcaagataatgatcagatttagatgggaggttgcggattgaatgaagacgttgattatttacttgtta-----gatgtgnnnnnnnaagcaata |
207 |
Q |
| |
|
||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||| |||||||||||| |||||| |||||||| |
|
|
| T |
7461937 |
agtgcttcaagataatgatcagatttaaacgggaggttgcggattgaatgaagacgttgatcatttacttgttacgttagatgtgtttttttaagcaata |
7462036 |
T |
|
| Q |
208 |
tttggtctttggttataaattgattaggttttattacattgcatcaagcttata--ttttggctcattatgatatgtttaggagcttaggtggtttctct |
305 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7462037 |
tttggtctttggttacaaattgattaggttttattacattgcatcaagcttatatattttggctcattatgatatgtttaggagcttaggtggtttctct |
7462136 |
T |
|
| Q |
306 |
aaccaaactcgtttagctttgaagatcattttgct |
340 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |
|
|
| T |
7462137 |
aaccaaactcgtttagctttcaagatcattttgct |
7462171 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University