View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1272-Insertion-1 (Length: 156)
Name: NF1272-Insertion-1
Description: NF1272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1272-Insertion-1 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 49; Significance: 2e-19; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 49; E-Value: 2e-19
Query Start/End: Original strand, 96 - 156
Target Start/End: Original strand, 52279516 - 52279576
Alignment:
| Q |
96 |
tatgatgtgatttcaattgtccctaagctttatatatttcttaaattctatcaatacatta |
156 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
52279516 |
tatgatgtgatgtcaattgtccctaagctttatatatttctcaaattctatcaataaatta |
52279576 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 48; Significance: 9e-19; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 48; E-Value: 9e-19
Query Start/End: Original strand, 8 - 67
Target Start/End: Complemental strand, 13743680 - 13743621
Alignment:
| Q |
8 |
taattgatggtataacagaaaacaaatgaaatctcacccaaatatgtatatattgtgaat |
67 |
Q |
| |
|
|||||||||||||||||||||||| || ||||||||||||||| |||||||||||||||| |
|
|
| T |
13743680 |
taattgatggtataacagaaaacatattaaatctcacccaaatgtgtatatattgtgaat |
13743621 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University