View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1272-Insertion-1 (Length: 156)

Name: NF1272-Insertion-1
Description: NF1272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1272-Insertion-1
NF1272-Insertion-1
[»] chr4 (1 HSPs)
chr4 (96-156)||(52279516-52279576)
[»] chr5 (1 HSPs)
chr5 (8-67)||(13743621-13743680)


Alignment Details
Target: chr4 (Bit Score: 49; Significance: 2e-19; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 49; E-Value: 2e-19
Query Start/End: Original strand, 96 - 156
Target Start/End: Original strand, 52279516 - 52279576
Alignment:
96 tatgatgtgatttcaattgtccctaagctttatatatttcttaaattctatcaatacatta 156  Q
    ||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| ||||    
52279516 tatgatgtgatgtcaattgtccctaagctttatatatttctcaaattctatcaataaatta 52279576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 48; Significance: 9e-19; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 48; E-Value: 9e-19
Query Start/End: Original strand, 8 - 67
Target Start/End: Complemental strand, 13743680 - 13743621
Alignment:
8 taattgatggtataacagaaaacaaatgaaatctcacccaaatatgtatatattgtgaat 67  Q
    |||||||||||||||||||||||| || ||||||||||||||| ||||||||||||||||    
13743680 taattgatggtataacagaaaacatattaaatctcacccaaatgtgtatatattgtgaat 13743621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University