View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1272-Insertion-12 (Length: 243)
Name: NF1272-Insertion-12
Description: NF1272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1272-Insertion-12 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 8 - 243
Target Start/End: Original strand, 39783641 - 39783876
Alignment:
| Q |
8 |
ctaacaagcttctccatgaatgatcaatttagtttctatagaggctaactagttttgaaccttctttgtcccaagtttaccttcatacacaggttaagct |
107 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39783641 |
ctaacaagcttctccatcaatgatcaatttagtttctatagaggctaactagttttgaaccttctttgtcccaagtttaccttcatacacaggttaagct |
39783740 |
T |
|
| Q |
108 |
taaatgaggaaaattctaagagaatagagttatttatgtagaaaataggattgattctaggaaagcacataaatatttatggtctaattgattcttgaaa |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39783741 |
taaatgaggaaaattctaagagaatagagttatttatatagaaaataggattgattctaggaaagcacataaatatttatggtctaattgattcttgaaa |
39783840 |
T |
|
| Q |
208 |
cattggcacaaaatgatggcatctacttccttttag |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
39783841 |
cattggcacaaaatgatggcatctacttccttttag |
39783876 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University