View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1272-Insertion-6 (Length: 385)
Name: NF1272-Insertion-6
Description: NF1272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1272-Insertion-6 |
 |  |
|
| [»] scaffold0576 (1 HSPs) |
 |  |  |
|
| [»] scaffold0070 (1 HSPs) |
 |  |  |
|
| [»] scaffold0102 (1 HSPs) |
 |  |  |
|
| [»] scaffold0019 (1 HSPs) |
 |  |  |
|
| [»] scaffold0217 (1 HSPs) |
 |  |  |
|
| [»] scaffold0026 (1 HSPs) |
 |  |  |
|
| [»] scaffold0366 (2 HSPs) |
 |  |  |
|
| [»] scaffold0051 (1 HSPs) |
 |  |  |
|
| [»] scaffold0623 (1 HSPs) |
 |  |  |
|
| [»] scaffold0328 (2 HSPs) |
 |  |  |
|
| [»] scaffold0016 (1 HSPs) |
 |  |  |
|
| [»] scaffold1175 (1 HSPs) |
 |  |  |
|
| [»] scaffold0068 (1 HSPs) |
 |  |  |
|
| [»] scaffold0049 (1 HSPs) |
 |  |  |
|
| [»] scaffold0459 (1 HSPs) |
 |  |  |
|
| [»] scaffold0717 (1 HSPs) |
 |  |  |
|
| [»] scaffold0157 (1 HSPs) |
 |  |  |
|
| [»] scaffold0199 (1 HSPs) |
 |  |  |
|
| [»] scaffold0011 (1 HSPs) |
 |  |  |
|
| [»] scaffold0028 (1 HSPs) |
 |  |  |
|
| [»] scaffold0020 (1 HSPs) |
 |  |  |
|
| [»] scaffold0300 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 187; Significance: 1e-101; HSPs: 72)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 5 - 282
Target Start/End: Complemental strand, 17579410 - 17579132
Alignment:
| Q |
5 |
acactatatggaatcattcctcagatttgcttcttgaaaggaatttctgtatttccaaaggtaaactacggatatgtagctaaacaagatttttattaca |
104 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
17579410 |
acactttatggaatcattcctcagatttgcttcttgaaaggaatttctgtatttccaaaggtaaactacggataagtagctaaacaagttttttattaca |
17579311 |
T |
 |
| Q |
105 |
agatgaatagtcaactatagttagttgatagtttcgggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgacttta |
204 |
Q |
| |
|
||||||||| |||||||||||||||||||||| || |||| |||| |||||||||| ||||||||||||||||||| ||||||| ||||||| ||||| |
|
|
| T |
17579310 |
agatgaataatcaactatagttagttgatagtctcaggtttgatttcctctagtgttaattttggtgggctaagtccatacagagcttgctttagcttta |
17579211 |
T |
 |
| Q |
205 |
aacggggccc-ccgcaagttggcggtgagattggtcccctcggattaatcgattattggatcggataccgagttttcag |
282 |
Q |
| |
|
|||||| ||| |||||||| ||||||||||||||||||||| ||||| |||||| |||||||| ||| ||||||||||| |
|
|
| T |
17579210 |
aacgggaccctccgcaagtgggcggtgagattggtcccctcagattagtcgatttttggatcgaatatcgagttttcag |
17579132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 141 - 281
Target Start/End: Complemental strand, 40133587 - 40133447
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| |||||||||| ||||||||||||| ||||||| ||||| || ||||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
40133587 |
ggttcgattccctctggtgtcaatttcggtgggctaagtccatacagagcttgctctggctttaaacggggcccccgcaagtgggcggtgggattggtcc |
40133488 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
||||| |||| |||||| ||||||||||||||||||||||| |
|
|
| T |
40133487 |
cctcgaattagtcgattcttggatcggataccgagttttca |
40133447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 91; E-Value: 5e-44
Query Start/End: Original strand, 141 - 279
Target Start/End: Complemental strand, 49258400 - 49258262
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||||||||| ||||||| ||||| || ||||||||||||||||| ||||| ||||||| ||||||||| |
|
|
| T |
49258400 |
ggttcgattccctctagtgccaatttcggtgggctaagtccatacagagcttgctctggctttaaacggggcccccacaagtgggcggtgggattggtcc |
49258301 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
49258300 |
cctcggattagtcgattcttggatcggataccgagtttt |
49258262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 89; E-Value: 8e-43
Query Start/End: Original strand, 141 - 281
Target Start/End: Complemental strand, 10190880 - 10190740
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
|||| |||||||||||||| |||||| ||||||||||||| ||||||| ||||| || ||||||||||||||||||||||| | ||||| ||||||||| |
|
|
| T |
10190880 |
ggtttgattccctctagtgccaatttcggtgggctaagtccatacagagcttgctctggctttaaacggggcccccgcaagtggacggtgggattggtcc |
10190781 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
10190780 |
cctcggattagtcgattcttggatcggataccgagttttca |
10190740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 141 - 279
Target Start/End: Original strand, 21363002 - 21363140
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| |||||||||| ||| ||||||||| ||||||| ||||| || |||||||||| |||||||||||| ||||||| ||||||| | |
|
|
| T |
21363002 |
ggttcgattccctctggtgtcaatttcggtaggctaagtccatacagagcttgctctggctttaaacggagcccccgcaagtgggcggtgggattggttc |
21363101 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
21363102 |
cctcggattaatcgattcttggatcggataccgagtttt |
21363140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 141 - 281
Target Start/End: Complemental strand, 8456288 - 8456148
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| ||| |||||| ||||||||||||| ||||||| ||||| || ||||||||||||||||||||||| ||| ||| ||||||||| |
|
|
| T |
8456288 |
ggttcgattccctctggtgccaatttcggtgggctaagtccatacagagcttgctctggctttaaacggggcccccgcaagtgggcagtgggattggtcc |
8456189 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||||||| |||||| ||| ||||||||||||||||||| |
|
|
| T |
8456188 |
cctcggattagtcgattcttgaatcggataccgagttttca |
8456148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 141 - 281
Target Start/End: Complemental strand, 10083957 - 10083817
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
|||| |||||||||||||| |||||| ||||||||||||| ||||||| ||||| || ||||||||||||||||| ||||| | ||||| ||||||||| |
|
|
| T |
10083957 |
ggtttgattccctctagtgccaatttcggtgggctaagtccatacagagcttgctctggctttaaacggggcccccacaagtggacggtgggattggtcc |
10083858 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
10083857 |
cctcggattagtcgattcttggatcggataccgagttttca |
10083817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 141 - 281
Target Start/End: Complemental strand, 15566637 - 15566498
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||||||||| ||||||| ||||| || ||||||||||| ||||||||||| ||||||| ||||||||| |
|
|
| T |
15566637 |
ggttcgattccctctagtgccaatttcggtgggctaagtccatacagagcttgctctggctttaaacggg-cccccgcaagtgggcggtgggattggtcc |
15566539 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||| ||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
15566538 |
cctcagattagtcgattcttggatcggataccgagttttca |
15566498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 141 - 281
Target Start/End: Complemental strand, 25289852 - 25289713
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||||||||| ||||||| ||||| || ||||||||||||||||||||||| ||||||| ||||||| | |
|
|
| T |
25289852 |
ggttcgattccctctagtgccaatttcggtgggctaagtccatacagagcttgctctggctttaaacggggcccccgcaagtgggcggtgggattggt-c |
25289754 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
||||| |||| |||||| ||||||||||||||||||||||| |
|
|
| T |
25289753 |
cctcgaattagtcgattcttggatcggataccgagttttca |
25289713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 141 - 279
Target Start/End: Original strand, 35492970 - 35493108
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| ||| |||||| ||||||||||||| ||||||| ||||| || ||||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
35492970 |
ggttcgattccctctggtgccaatttcggtgggctaagtccatacagagcttgctctggctttaaacggggcccccgcaagtgggcggtgggattggtcc |
35493069 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
|||||||||| |||||| |||||| | |||||||||||| |
|
|
| T |
35493070 |
cctcggattagtcgattcttggattgaataccgagtttt |
35493108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 141 - 281
Target Start/End: Complemental strand, 8097417 - 8097277
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| ||| ||||| | ||||||||||| ||||||| |||| || ||||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
8097417 |
ggttcgattccctcttgtgctaatttcgatgggctaagtccatacagagcatgctctggctttaaacggggcccccgcaagtgggcggtgggattggtcc |
8097318 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
8097317 |
cctcggattagtcgattcttggatcggataccgagttttca |
8097277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 143 - 279
Target Start/End: Original strand, 32151485 - 32151621
Alignment:
| Q |
143 |
ttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcccc |
242 |
Q |
| |
|
|||||||| |||||||| |||||| ||||||||||| ||||||| ||||| || ||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
32151485 |
ttcgattctctctagtgccaatttcggtgggctaagctcatacagagcttgctctggctttaaacggggcccccgcaagtgggcggtgagattggtcccc |
32151584 |
T |
 |
| Q |
243 |
tcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
||| |||| |||||| ||||||||||||||||||||| |
|
|
| T |
32151585 |
tcgaattagtcgattcttggatcggataccgagtttt |
32151621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 141 - 281
Target Start/End: Original strand, 46576407 - 46576547
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| ||| |||||| |||||||||||| ||||||| ||||| || ||||||||||||||||||||||| |||||| ||||||||| |
|
|
| T |
46576407 |
ggttcgattccctctggtgccaatttcagtgggctaagtccatacagagcttgctctggctttaaacggggcccccgcaagtgggcggtcggattggtcc |
46576506 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
||| |||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
46576507 |
ccttggattagtcgattcttggatcggataccgagttttca |
46576547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 141 - 281
Target Start/End: Complemental strand, 53424314 - 53424175
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||| | ||| |||||| ||||||||||||| ||||||| |||||| || ||||||||||| ||||||||||| |||||| ||||||||| |
|
|
| T |
53424314 |
ggttcgattccctttggtgccaatttcggtgggctaagtccatacagagtttgctatggctttaaacggg-cccccgcaagtgagcggtgggattggtcc |
53424216 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
53424215 |
cctcggattagtcgattcttggatcggataccgagttttca |
53424175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 141 - 279
Target Start/End: Complemental strand, 18177025 - 18176887
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| ||| |||||| ||||| ||||||| ||||||| ||||| || ||||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
18177025 |
ggttcgattccctctggtgccaatttcggtggactaagtccatacagagcttgctctggctttaaacggggcccccgcaagtgggcggtgggattggtcc |
18176926 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
| |||||||| |||||| ||||||||||||| ||||||| |
|
|
| T |
18176925 |
catcggattagtcgattcttggatcggatacagagtttt |
18176887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 143 - 281
Target Start/End: Complemental strand, 45272552 - 45272414
Alignment:
| Q |
143 |
ttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcccc |
242 |
Q |
| |
|
||||||||||||| ||| |||||| ||||||||||||| |||| || ||||| || ||||||||||||||||||||||| ||||||| ||||||||||| |
|
|
| T |
45272552 |
ttcgattccctctggtgccaatttcggtgggctaagtccatacggagcttgctctggctttaaacggggcccccgcaagtgggcggtgggattggtcccc |
45272453 |
T |
 |
| Q |
243 |
tcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||||| | || | ||||||||||||||||||||||| |
|
|
| T |
45272452 |
tcggattagttgactcttggatcggataccgagttttca |
45272414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 141 - 278
Target Start/End: Original strand, 25379820 - 25379957
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||| ||||||| |||||| || |||||||||| ||||||| ||||| || |||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
25379820 |
ggttcgattccttctagtgccaatttcggagggctaagtccatacagagcttgctctggctttaaacggggcccccgcaagcgggcggtgggattggtcc |
25379919 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttt |
278 |
Q |
| |
|
|||||||||| |||||| ||||||||||||| |||||| |
|
|
| T |
25379920 |
cctcggattagtcgattcttggatcggatactgagttt |
25379957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 143 - 279
Target Start/End: Original strand, 24407322 - 24407458
Alignment:
| Q |
143 |
ttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcccc |
242 |
Q |
| |
|
|||||||| |||| ||| ||||| |||||| ||||| |||||||||||||| ||||||||||||||||| ||||||| ||||||| ||||||||||| |
|
|
| T |
24407322 |
ttcgattctctctggtgctaatttcggtgggttaagtatatacagaatttgctctgactttaaacggggccatcgcaagtgggcggtgggattggtcccc |
24407421 |
T |
 |
| Q |
243 |
tcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
|||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
24407422 |
tcggattagtcgattcttggatcggataccgagtttt |
24407458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 141 - 281
Target Start/End: Original strand, 26174172 - 26174312
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||| ||||| ||| |||||| |||||| |||||| ||||||| ||||| || ||||||| |||||||||||||| ||||||| ||||||||| |
|
|
| T |
26174172 |
ggttcgatttcctctggtgccaatttcggtgggttaagtccatacagagcttgctctggctttaaatagggcccccgcaagtgggcggtgggattggtcc |
26174271 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
26174272 |
cctcggattagtcgattcttggatcggataccgagttttca |
26174312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 141 - 281
Target Start/End: Complemental strand, 52455787 - 52455647
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| ||| |||||||| ||||||||||| | ||||| ||||| |||||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
52455787 |
ggttcgattccctctggtgccaattttgatgggctaagtctacacagagcttgctctgactttaaacggggcccccgcaagtgactggtgggattggtcc |
52455688 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||||||| |||||| |||||| |||||||||||||||| |
|
|
| T |
52455687 |
cctcggattagtcgattcttggattggataccgagttttca |
52455647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 141 - 281
Target Start/End: Complemental strand, 53234048 - 53233909
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
|||||||||| |||| ||| |||||| ||||||||||||| ||||||| ||||| || || |||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
53234048 |
ggttcgattctctctggtgccaatttcggtgggctaagtccatacagagcttgctctggctctaaacggggcccccgcaagtgggcggtgggattggtcc |
53233949 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||||||| |||||| || |||||||||||||||||||| |
|
|
| T |
53233948 |
cctcggattagtcgattctt-gatcggataccgagttttca |
53233909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 141 - 279
Target Start/End: Complemental strand, 52821773 - 52821636
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| ||| |||||| |||| |||||||| ||||||| ||||| || |||||||||||||||| | |||| ||||||| ||||||||| |
|
|
| T |
52821773 |
ggttcgattccctctggtgccaatttcggtgagctaagtccatacagagcttgctctggctttaaacggggcccc-gtaagtgggcggtgggattggtcc |
52821675 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
52821674 |
cctcggattagtcgattcttggatcggataccgagtttt |
52821636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 141 - 281
Target Start/End: Complemental strand, 30807291 - 30807151
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggc-ccccgcaagttggcggtgagattggtc |
239 |
Q |
| |
|
||||||||||||||| ||| |||||| ||||||||||||| ||||||| ||||| || ||||||||||||| |||||||||| |||||| ||||||| |
|
|
| T |
30807291 |
ggttcgattccctctggtgccaatttcggtgggctaagtccatacagagcttgctctggctttaaacggggccccccgcaagtgggcggtaggattggt- |
30807193 |
T |
 |
| Q |
240 |
ccctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
||||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
30807192 |
ccctcggattagtcgattcttggatcggataccgagttttca |
30807151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 142 - 279
Target Start/End: Complemental strand, 33398605 - 33398468
Alignment:
| Q |
142 |
gttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtccc |
241 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| || ||| ||||||| ||||| | ||||||||||||||||||||||| ||||||| ||||||| || |
|
|
| T |
33398605 |
gttcgattccctctagtgccaattttggtgggttatgtccatacagagcttgctctagctttaaacggggcccccgcaagtgggcggtgggattggttcc |
33398506 |
T |
 |
| Q |
242 |
ctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
|||| |||| |||||| |||||||||||||||| |||| |
|
|
| T |
33398505 |
ctcgaattagtcgattcttggatcggataccgaatttt |
33398468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 142 - 279
Target Start/End: Complemental strand, 39041989 - 39041852
Alignment:
| Q |
142 |
gttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtccc |
241 |
Q |
| |
|
||||||||| |||| ||| |||||| ||||||||||||| || |||| ||||| || ||||||||||||||||||||||| || |||| ||||||||| |
|
|
| T |
39041989 |
gttcgattctctctggtgccaatttcggtgggctaagtccatgcagagcttgctctggctttaaacggggcccccgcaagtgggtggtgggattggtcca |
39041890 |
T |
 |
| Q |
242 |
ctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
39041889 |
ctcggattagtcgattcttggatcggataccgagtttt |
39041852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 142 - 281
Target Start/End: Complemental strand, 8958173 - 8958033
Alignment:
| Q |
142 |
gttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaac-ggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
|||||||| ||||| |||||||||||||||||||||||| ||||| | ||||| | ||||||| ||||||||||||||| ||||||| ||||||||| |
|
|
| T |
8958173 |
gttcgatttcctctggtgtcaattttggtgggctaagtccatacaaagcttgctctagctttaaaatggggcccccgcaagtgggcggtgggattggtcc |
8958074 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||| |||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
8958073 |
cctctgattaatcgattcttggatcagataccgagttttca |
8958033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 141 - 281
Target Start/End: Complemental strand, 45529892 - 45529753
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| | | |||||| | ||||||||||| ||||||| ||||| || ||||||||||| ||||||||||| ||||||| ||||||||| |
|
|
| T |
45529892 |
ggttcgattccctctggagccaatttcgatgggctaagtccatacagagcttgctctggctttaaacgggccccccgcaagtgggcggtgggattggtcc |
45529793 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||||||| |||||| || |||||||||||||||||||| |
|
|
| T |
45529792 |
cctcggattagtcgattctt-gatcggataccgagttttca |
45529753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 141 - 281
Target Start/End: Original strand, 48977447 - 48977587
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||| ||| ||| |||||| |||||| |||||| ||||||| ||||| || |||||||||||||||| |||||| ||||||| ||||||||| |
|
|
| T |
48977447 |
ggttcgattccttctggtgccaatttcggtgggttaagtccatacagagcttgctctggctttaaacggggcccctgcaagtgggcggtgggattggtcc |
48977546 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||||||| ||| | ||||||||||||||||||||||| |
|
|
| T |
48977547 |
cctcggattagtcggtccttggatcggataccgagttttca |
48977587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 146 - 279
Target Start/End: Complemental strand, 31537971 - 31537838
Alignment:
| Q |
146 |
gattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcccctcg |
245 |
Q |
| |
|
|||||||||| ||| |||||||||||||||||||| ||||||| || || || |||||||||| ||||| |||||| |||||||||||||||||||||| |
|
|
| T |
31537971 |
gattccctctggtgccaattttggtgggctaagtctatacagagcttactctggctttaaacggagcccctgcaagtgggcggtgagattggtcccctcg |
31537872 |
T |
 |
| Q |
246 |
gattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
|||| || ||| |||||||||||| |||||||| |
|
|
| T |
31537871 |
aattagtcaattcttggatcggatatcgagtttt |
31537838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 141 - 281
Target Start/End: Original strand, 30257683 - 30257823
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||| | ||| |||||| | ||| ||||||| ||||||| ||||| || ||||||| ||||||||||||||| ||||||| |||||||| |
|
|
| T |
30257683 |
ggttcgattccctttggtgccaatttcgatggactaagtccatacagagcttgctctggctttaaatggggcccccgcaagtgggcggtggcattggtcc |
30257782 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||||||| |||||| |||||||||||||||| |||||| |
|
|
| T |
30257783 |
cctcggattagtcgattcttggatcggataccgaattttca |
30257823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 141 - 281
Target Start/End: Original strand, 40940884 - 40941024
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| ||| |||||| ||||| ||||||| ||||||| ||||| |||||||||||||||||||| ||||| || ||| ||||||||| |
|
|
| T |
40940884 |
ggttcgattccctctggtgccaatttcggtggactaagtccatacagagcttgctctgactttaaacggggcccccacaagtgggtggtaggattggtcc |
40940983 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
||||| |||| || ||| ||| ||| ||||||||||||||| |
|
|
| T |
40940984 |
cctcgaattactcaattcttgaatcagataccgagttttca |
40941024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 142 - 279
Target Start/End: Complemental strand, 34492712 - 34492575
Alignment:
| Q |
142 |
gttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtccc |
241 |
Q |
| |
|
|||||||||||||| || |||||| | ||||||||||| ||||||| ||||| || ||||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
34492712 |
gttcgattccctctgctgccaatttcgttgggctaagtccatacagagcttgctctggctttaaacggggcccccgcaagtgggcggtgggattggtcca |
34492613 |
T |
 |
| Q |
242 |
ctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
|| ||||| | |||| ||||||| ||||||||||||| |
|
|
| T |
34492612 |
ttcagattagttgattcttggatctgataccgagtttt |
34492575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 141 - 281
Target Start/End: Complemental strand, 2511435 - 2511295
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| ||| |||||| |||||||||||| ||||||| | ||| |||||||||||||| || |||||||| ||||||| |||||||| |
|
|
| T |
2511435 |
ggttcgattccctctggtgccaatttcggtgggctaagttcatacagagctcgctctgactttaaacgggacctccgcaagtgggcggtgggattggtct |
2511336 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
||||| |||| | |||| ||| |||||||||| |||||||| |
|
|
| T |
2511335 |
cctcgaattagtagattcttgaatcggataccaagttttca |
2511295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 141 - 281
Target Start/End: Complemental strand, 25344195 - 25344056
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
|||| |||||||| | ||||||||||| |||| ||||||| ||||||| |||||| || ||||||||||||||||||| ||| |||| || ||||||| |
|
|
| T |
25344195 |
ggtttgattccctttggtgtcaatttttgtggtctaagtccatacagagtttgctctggctttaaacggggcccccgctagtgggcgatgggattggt-t |
25344097 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||||||| |||||| || ||||| |||||||||||||| |
|
|
| T |
25344096 |
cctcggattagtcgattcttagatcgaataccgagttttca |
25344056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 141 - 279
Target Start/End: Original strand, 1692893 - 1693030
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||| | |||||||||||| ||||| ||||||| |||||||| ||||| || ||||| || || ||||||||||| ||||||| |||| | || |
|
|
| T |
1692893 |
ggttcgattccatttagtgtcaatttcggtggactaagtctatacagaacttgctctggctttagacagg-cccccgcaagtgggcggtgggatttgccc |
1692991 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
|||| ||||| |||||| ||| ||||||||||||||||| |
|
|
| T |
1692992 |
cctcagattagtcgattcttgaatcggataccgagtttt |
1693030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 176 - 281
Target Start/End: Complemental strand, 24165817 - 24165713
Alignment:
| Q |
176 |
aagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcccctcggattaatcgattattggatcggataccgag |
275 |
Q |
| |
|
||||| ||||||| ||||| || |||||||||||||||| |||||| ||||||| ||||| ||||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
24165817 |
aagtccatacagagcttgctctggctttaaacggggcccc-gcaagtgggcggtgggattgttcccctcggattagtcgattcttggatcggataccgag |
24165719 |
T |
 |
| Q |
276 |
ttttca |
281 |
Q |
| |
|
|||||| |
|
|
| T |
24165718 |
ttttca |
24165713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 182 - 279
Target Start/End: Original strand, 54475781 - 54475878
Alignment:
| Q |
182 |
atacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcccctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
||||||| |||||||| |||||||||||||| |||||||| ||||||| |||||||||||| |||||| |||||| ||||||| ||||||||||||| |
|
|
| T |
54475781 |
atacagagcttgctttggctttaaacggggccaccgcaagtgggcggtgggattggtccccttggattagtcgattcttggatcagataccgagtttt |
54475878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 191 - 278
Target Start/End: Original strand, 48104986 - 48105073
Alignment:
| Q |
191 |
ttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcccctcggattaatcgattattggatcggataccgagttt |
278 |
Q |
| |
|
||||| || |||||||| |||||||| ||||| |||||||||||||||||| |||||||| |||||| |||||||||||||||||||| |
|
|
| T |
48104986 |
ttgctctggctttaaacagggcccccacaagtgggcggtgagattggtcccttcggattagtcgattcttggatcggataccgagttt |
48105073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 144 - 279
Target Start/End: Complemental strand, 53288847 - 53288713
Alignment:
| Q |
144 |
tcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcccct |
243 |
Q |
| |
|
|||||||||||| ||| |||||| ||||| ||||||| ||||| | |||||||| |||||||||||| |||||||| | |||||||||| ||||||| |
|
|
| T |
53288847 |
tcgattccctctggtgccaatttcggtggactaagtccatacaaagcttgctttggctttaaacgggg-ccccgcaaacggacggtgagattagtcccct |
53288749 |
T |
 |
| Q |
244 |
cggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
|| |||| |||||||||||||||| |||| |||||| |
|
|
| T |
53288748 |
cgaattagtcgattattggatcggttaccaagtttt |
53288713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 136 - 281
Target Start/End: Original strand, 11390656 - 11390801
Alignment:
| Q |
136 |
tttcgggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagatt |
235 |
Q |
| |
|
|||| |||| |||| ||||| |||||||||||||||||||||||| ||||||| ||||| || ||||||| ||| || |||||| | |||||||| |
|
|
| T |
11390656 |
tttcaggtttgatttcctctggtgtcaattttggtgggctaagtccatacagagcttgctctgtctttaaatgggtcctccgcaaatgattcgtgagatt |
11390755 |
T |
 |
| Q |
236 |
ggtcccctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
||||||||||||| |||||| ||||||||||||| ||||||||| |
|
|
| T |
11390756 |
attcccctcggattagtcgattcttggatcggatactgagttttca |
11390801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 212 - 281
Target Start/End: Complemental strand, 53848501 - 53848432
Alignment:
| Q |
212 |
cccccgcaagttggcggtgagattggtcccctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
53848501 |
cccccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagttttca |
53848432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 142 - 281
Target Start/End: Original strand, 51532849 - 51532988
Alignment:
| Q |
142 |
gttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtccc |
241 |
Q |
| |
|
||||||||| ||||| || |||||| ||||||||||||| ||||||| ||||| | |||||||| ||| ||||||||||| | ||||| |||||||||| |
|
|
| T |
51532849 |
gttcgattctctctaatgccaatttcggtgggctaagtccatacagagcttgctctaactttaaatgggacccccgcaagtggacggtgggattggtccc |
51532948 |
T |
 |
| Q |
242 |
ctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
||| ||||| ||| || ||| || |||||||||||||| |
|
|
| T |
51532949 |
ctcagattagtcggttcttgatccgaataccgagttttca |
51532988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 141 - 235
Target Start/End: Original strand, 26108351 - 26108445
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagatt |
235 |
Q |
| |
|
||||||||||||||| ||| |||||| ||||||||||||| ||||||| ||||| || ||||||||||||||||||||||| ||| ||| |||| |
|
|
| T |
26108351 |
ggttcgattccctctggtgccaatttcggtgggctaagtccatacagagcttgctctggctttaaacggggcccccgcaagtgggctgtgggatt |
26108445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 141 - 281
Target Start/End: Original strand, 1178231 - 1178369
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaa-tttgctttgactttaaacggggcccccgcaagttggcggtgagattggtc |
239 |
Q |
| |
|
|||||||||| | || ||| |||||| ||||||| ||||| |||||||| |||||| || ||||||| |||||||| || || ||||||| |||||||| |
|
|
| T |
1178231 |
ggttcgattctccctggtgccaatttcggtgggc-aagtccatacagaactttgctctggctttaaatggggcccca-cacgtgggcggtgggattggtc |
1178328 |
T |
 |
| Q |
240 |
ccctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|| |||||||| |||| | ||||||||||||||||||||||| |
|
|
| T |
1178329 |
cc-tcggattagtcgaatcttggatcggataccgagttttca |
1178369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 141 - 250
Target Start/End: Complemental strand, 7470353 - 7470245
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
|||||||||||||||| || |||||| |||||||||||| ||||||| ||||| || |||||||||||| ||| |||||| ||| ||| ||||||||| |
|
|
| T |
7470353 |
ggttcgattccctctaatgccaatttcggtgggctaagttcatacagagcttgctctggctttaaacgggg-ccctgcaagtgggcagtgggattggtcc |
7470255 |
T |
 |
| Q |
241 |
cctcggatta |
250 |
Q |
| |
|
|||| ||||| |
|
|
| T |
7470254 |
cctcagatta |
7470245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 145 - 248
Target Start/End: Original strand, 1242036 - 1242139
Alignment:
| Q |
145 |
cgattccctctagtgtcaattttggtgggctaagtcaatacaga-atttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcccct |
243 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||||| ||||||| |||||| || |||||||||||| ||||||||| ||||||| ||||||||||| |
|
|
| T |
1242036 |
cgattccctctggtgccaattttggtgggctaagtccatacagagctttgctctggctttaaacgggg-tcccgcaagtgggcggtggaattggtcccct |
1242134 |
T |
 |
| Q |
244 |
cggat |
248 |
Q |
| |
|
|||| |
|
|
| T |
1242135 |
tggat |
1242139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 204 - 271
Target Start/End: Complemental strand, 55371369 - 55371302
Alignment:
| Q |
204 |
aaacggggcccccgcaagttggcggtgagattggtcccctcggattaatcgattattggatcggatac |
271 |
Q |
| |
|
||||||||||| ||||||| ||||||| ||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
55371369 |
aaacggggccctcgcaagtgggcggtgggattggtcccctcggattagtcgatccttggatcggatac |
55371302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 232 - 281
Target Start/End: Original strand, 3747731 - 3747780
Alignment:
| Q |
232 |
gattggtcccctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
3747731 |
gattggtcccctcggattagtcgattcttggatcggataccgagttttca |
3747780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 141 - 279
Target Start/End: Complemental strand, 48972849 - 48972714
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| ||| |||||| | |||| ||||| ||| ||| |||||| ||||||||||||| ||| ||||| || ||||| |||||||| |
|
|
| T |
48972849 |
ggttcgattccctctggtgccaatttcgatgggttaagttcatatagagtttgctctgactttaaacggatccc---caagtggggggtgaaattggtcc |
48972753 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
||| |||| |||||| ||| ||||||||||||||||| |
|
|
| T |
48972752 |
attcgaattagtcgattcttgaatcggataccgagtttt |
48972714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 142 - 279
Target Start/End: Complemental strand, 6041809 - 6041670
Alignment:
| Q |
142 |
gttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatt-tgctttgactttaaacggggcccccg-caagttggcggtgagattggtc |
239 |
Q |
| |
|
|||||||| || |||||| |||||| ||||| |||||| ||||||| || |||| |||||||||||| |||||| ||| | ||||||||||||| || |
|
|
| T |
6041809 |
gttcgattgcccctagtgccaatttcggtggattaagtccatacagagttatgctctgactttaaacgaagcccccctcaaatgggcggtgagattgttc |
6041710 |
T |
 |
| Q |
240 |
ccctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
|||| ||||| ||| || ||||||| ||||||||||||| |
|
|
| T |
6041709 |
cccttagattagtcggttcttggatcagataccgagtttt |
6041670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 190 - 281
Target Start/End: Complemental strand, 33698795 - 33698704
Alignment:
| Q |
190 |
tttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcccctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||| || ||||||||||||| ||||||| | || |||| ||||||||||||| |||| |||||| | ||||||||| ||||||||||| |
|
|
| T |
33698795 |
tttgctctggctttaaacggggctcccgcaaatgggtggtgggattggtcccctcaaattagtcgattctcggatcggatgccgagttttca |
33698704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 208 - 279
Target Start/End: Complemental strand, 50731308 - 50731237
Alignment:
| Q |
208 |
ggggcccccgcaagttggcggtgagattggtcccctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
||||||| | ||||| ||||||| ||||||||||||| ||||| ||||| ||||||||||||||||||||| |
|
|
| T |
50731308 |
ggggcccacacaagtgggcggtgggattggtcccctcagattagtcgatccttggatcggataccgagtttt |
50731237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 208 - 279
Target Start/End: Original strand, 50781546 - 50781617
Alignment:
| Q |
208 |
ggggcccccgcaagttggcggtgagattggtcccctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
||||||| | ||||| ||||||| ||||||||||||| ||||| ||||| ||||||||||||||||||||| |
|
|
| T |
50781546 |
ggggcccacacaagtgggcggtgggattggtcccctcagattagtcgatccttggatcggataccgagtttt |
50781617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 217 - 279
Target Start/End: Original strand, 4048085 - 4048147
Alignment:
| Q |
217 |
gcaagttggcggtgagattggtcccctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
|||||| | ||||| ||||||||||||||||||| | |||| ||||||||||||||||||||| |
|
|
| T |
4048085 |
gcaagtggacggtgggattggtcccctcggattagttgattcttggatcggataccgagtttt |
4048147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 210 - 279
Target Start/End: Complemental strand, 7485599 - 7485531
Alignment:
| Q |
210 |
ggcccccgcaagttggcggtgagattggtcccctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
|||||| |||||| | ||||| |||||||||| |||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
7485599 |
ggcccctgcaagtggccggtgggattggtccc-tcggattagtcgattcttggatcggataccgagtttt |
7485531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 205 - 274
Target Start/End: Original strand, 26158934 - 26159003
Alignment:
| Q |
205 |
aacggggcccccgcaagttggcggtgagattggtcccctcggattaatcgattattggatcggataccga |
274 |
Q |
| |
|
||||| |||||||||||| ||||||| ||||| ||||||||||||| ||| | |||||||||||||||| |
|
|
| T |
26158934 |
aacggagcccccgcaagtgggcggtgggattgatcccctcggattagtcggtccttggatcggataccga |
26159003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 135 - 177
Target Start/End: Complemental strand, 8075142 - 8075100
Alignment:
| Q |
135 |
gtttcgggttcgattccctctagtgtcaattttggtgggctaa |
177 |
Q |
| |
|
||||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
8075142 |
gtttcaggttcgattccctctagtgtcaatttgggtgggctaa |
8075100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 340 - 378
Target Start/End: Complemental strand, 17579087 - 17579049
Alignment:
| Q |
340 |
ttaacctatcaactaatatttttcatgaaaataatttaa |
378 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
17579087 |
ttaacctatcaactaatatttttcaagaaaataatttaa |
17579049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 142 - 279
Target Start/End: Original strand, 4462693 - 4462829
Alignment:
| Q |
142 |
gttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtccc |
241 |
Q |
| |
|
|||||||||||||| | |||||| | |||||||||| ||||||| || || | |||||||||||||||| |||||| | ||||| ||||| ||| |
|
|
| T |
4462693 |
gttcgattccctctggcaccaatttcgatgggctaagttcatacagagcttactctagctttaaacggggcccc-gcaagtggacggtgggattgatcca |
4462791 |
T |
 |
| Q |
242 |
ctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
||||||||| | ||| |||||| |||||||||||||| |
|
|
| T |
4462792 |
ctcggattagtttattcttggattggataccgagtttt |
4462829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 197 - 281
Target Start/End: Original strand, 7195922 - 7196006
Alignment:
| Q |
197 |
tgactttaaacggggcccccgcaagttggcggtgagattggtcccctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||||||| ||| ||||| || || ||| ||| ||||||||||||| ||||| |||||| || ||| ||||||||||||||| |
|
|
| T |
7195922 |
tgactttaaatgggccccccacatgtgggcagtgggattggtcccctcagattagtcgattctttgattagataccgagttttca |
7196006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 227 - 279
Target Start/End: Original strand, 14997755 - 14997807
Alignment:
| Q |
227 |
ggtgagattggtcccctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
|||| |||||||||||||| ||||||||||| ||| ||| ||||||||||||| |
|
|
| T |
14997755 |
ggtgggattggtcccctcgaattaatcgattcttgtatcagataccgagtttt |
14997807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 141 - 257
Target Start/End: Complemental strand, 29915407 - 29915292
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||| | ||| ||| || ||| |||||||||||| ||||||| |||| || ||||||||||| ||||||||||| ||||||| ||||| ||| |
|
|
| T |
29915407 |
ggttcgatttcttctggtgccattttcggtgggctaagtacatacagagcttgccctggctttaaacggg-cccccgcaagtgggcggtgggattgatcc |
29915309 |
T |
 |
| Q |
241 |
cctcggattaatcgatt |
257 |
Q |
| |
|
| ||| |||| |||||| |
|
|
| T |
29915308 |
catcgaattagtcgatt |
29915292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 141 - 257
Target Start/End: Complemental strand, 29964560 - 29964445
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||| | ||| ||| || ||| |||||||||||| ||||||| |||| || ||||||||||| ||||||||||| ||||||| ||||| ||| |
|
|
| T |
29964560 |
ggttcgatttcttctggtgccattttcggtgggctaagtacatacagagcttgccctggctttaaacggg-cccccgcaagtgggcggtgggattgatcc |
29964462 |
T |
 |
| Q |
241 |
cctcggattaatcgatt |
257 |
Q |
| |
|
| ||| |||| |||||| |
|
|
| T |
29964461 |
catcgaattagtcgatt |
29964445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 219 - 279
Target Start/End: Complemental strand, 51390193 - 51390133
Alignment:
| Q |
219 |
aagttggcggtgagattggtcccctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| ||| || || || |||||||||| |||| |
|
|
| T |
51390193 |
aagtgggcggtgagattggtcccctcggattagtcggttgttagaccggataccgattttt |
51390133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 212 - 271
Target Start/End: Complemental strand, 4252463 - 4252404
Alignment:
| Q |
212 |
cccccgcaagttggcggtgagattggtcccctcggattaatcgattattggatcggatac |
271 |
Q |
| |
|
||||| ||||| | ||||| ||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
4252463 |
cccccacaagtggacggtgggattggtcccctcggattagtcgatccttggatcggatac |
4252404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 141 - 180
Target Start/End: Original strand, 25017574 - 25017613
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtc |
180 |
Q |
| |
|
||||||||||| |||||||||||||| ||||||||||||| |
|
|
| T |
25017574 |
ggttcgattccatctagtgtcaatttcggtgggctaagtc |
25017613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 226 - 281
Target Start/End: Original strand, 55287929 - 55287984
Alignment:
| Q |
226 |
cggtgagattggtcccctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
||||| |||| ||||||| | |||| ||||||||||||||||||||||| |||||| |
|
|
| T |
55287929 |
cggtgggattagtccccttgaattagtcgattattggatcggataccgaattttca |
55287984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 213 - 279
Target Start/End: Original strand, 25017620 - 25017685
Alignment:
| Q |
213 |
ccccgcaagttggcggtgagattggtcccctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
|||||||||| ||||||| ||||||| || | |||||| |||||| |||||||| |||||||||||| |
|
|
| T |
25017620 |
ccccgcaagtgggcggtgggattggttcctt-ggattagtcgattcttggatcgaataccgagtttt |
25017685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 190 - 243
Target Start/End: Original strand, 31766799 - 31766852
Alignment:
| Q |
190 |
tttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcccct |
243 |
Q |
| |
|
||||||||||||| ||||| |||||| ||||| ||||||| |||||||||||| |
|
|
| T |
31766799 |
tttgctttgacttaaaacgaggcccctgcaagcaggcggtgggattggtcccct |
31766852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 200 - 281
Target Start/End: Complemental strand, 32094836 - 32094755
Alignment:
| Q |
200 |
ctttaaacggggcccccgcaagttggcggtgagattggtcccctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
||||||| ||||| |||| ||| || |||| ||||||||| ||| |||| ||| || ||||||||||||||||||||||| |
|
|
| T |
32094836 |
ctttaaatggggctcccgtaagcgggtggtgggattggtcctctcatattagtcggttcttggatcggataccgagttttca |
32094755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 135 - 175
Target Start/End: Original strand, 36720442 - 36720482
Alignment:
| Q |
135 |
gtttcgggttcgattccctctagtgtcaattttggtgggct |
175 |
Q |
| |
|
||||| |||||||||| ||||||||||||||| |||||||| |
|
|
| T |
36720442 |
gtttcaggttcgattctctctagtgtcaatttaggtgggct |
36720482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 229 - 281
Target Start/End: Complemental strand, 39890656 - 39890604
Alignment:
| Q |
229 |
tgagattggtcccctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||||||||| ||||| || |||||| |||||||||||||||| |||||| |
|
|
| T |
39890656 |
tgagattggtccaatcggactagtcgattcttggatcggataccgaattttca |
39890604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 97; Significance: 1e-47; HSPs: 59)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 141 - 281
Target Start/End: Complemental strand, 7085764 - 7085624
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||| ||||||| ||||| ||||||||||||||| |||||||||| ||||||| ||||||||| |
|
|
| T |
7085764 |
ggttcgattccctctagtgtcaatttcggtgggctaagtccatacagagcttgctctgactttaaacggggtccccgcaagtgggcggtgggattggtcc |
7085665 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||||||| |||||| ||| ||||||||||||||||||| |
|
|
| T |
7085664 |
cctcggattagtcgattcttgaatcggataccgagttttca |
7085624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 89; E-Value: 8e-43
Query Start/End: Original strand, 141 - 281
Target Start/End: Complemental strand, 27498869 - 27498729
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| ||| |||||| ||||||||||||| ||||| | ||||| || ||||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
27498869 |
ggttcgattccctctggtgccaatttcggtgggctaagtccatacatagcttgctctggctttaaacggggcccccgcaagtgggcggtgggattggtcc |
27498770 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
27498769 |
cctcggattagtcgattcttggatcggataccgagttttca |
27498729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 141 - 281
Target Start/End: Complemental strand, 8484799 - 8484659
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
|||| |||||||||| ||| |||||| |||||||||||| ||||||| ||||| || ||||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
8484799 |
ggtttgattccctctggtgccaatttcggtgggctaagttcatacagagcttgctctggctttaaacggggcccccgcaagtgggcggtgggattggtcc |
8484700 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
8484699 |
cctcggattagtcgattcttggatcggataccgagttttca |
8484659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 141 - 281
Target Start/End: Complemental strand, 15641243 - 15641104
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| | | |||||| ||||||||||||| ||||||| ||||| || ||||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
15641243 |
ggttcgattccctctggagccaatttcggtgggctaagtccatacagagcttgctctggctttaaacggggcccccgcaagtgggcggtgggattggtcc |
15641144 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||||||| |||||| || |||||||||||||||||||| |
|
|
| T |
15641143 |
cctcggattagtcgattctt-gatcggataccgagttttca |
15641104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 141 - 281
Target Start/End: Original strand, 18207266 - 18207406
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
|||||||||||||| ||| |||||| ||||||||||||| ||||||| ||| | || ||||||||| ||||||||||||| ||||||| ||||||||| |
|
|
| T |
18207266 |
ggttcgattccctccggtgccaatttcggtgggctaagtccatacagagcttgttctggctttaaacgaggcccccgcaagtgggcggtgggattggtcc |
18207365 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
18207366 |
cctcggattagtcgattcttggatcggataccgagttttca |
18207406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 141 - 281
Target Start/End: Complemental strand, 21236500 - 21236360
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
|||||||||| ||||||||||||||| ||||||||||| ||||||| ||| || |||||||||||||||||||||||||| ||||||| |||| |||| |
|
|
| T |
21236500 |
ggttcgattctctctagtgtcaatttcaatgggctaagtccatacagagttttctctgactttaaacggggcccccgcaagtgggcggtgggattagtcc |
21236401 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||| ||||| |||||| ||| ||||||||||||||||||| |
|
|
| T |
21236400 |
cctcagattagtcgattcttgaatcggataccgagttttca |
21236360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 141 - 281
Target Start/End: Original strand, 30485887 - 30486027
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
|||||||||| |||| |||||||||| ||||||||||||| ||||||| ||||| || ||||||||| |||||||||||| ||||||| ||||||||| |
|
|
| T |
30485887 |
ggttcgattcactctggtgtcaatttcggtgggctaagtccatacagagcttgctctggctttaaacgatgcccccgcaagtgggcggtgggattggtcc |
30485986 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||||||| || ||| ||||||||||||||||||||||| |
|
|
| T |
30485987 |
cctcggattagtcaattcttggatcggataccgagttttca |
30486027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 141 - 281
Target Start/End: Complemental strand, 32059578 - 32059438
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||| ||| ||| |||||| ||||||||||||| ||||||| ||||| || ||||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
32059578 |
ggttcgattccttctggtgccaatttcggtgggctaagtccatacagagcttgctctggctttaaacggggcccccgcaagtgggcggtgggattggtcc |
32059479 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||||||| ||| | ||||||||||||||||||||||| |
|
|
| T |
32059478 |
cctcggattagtcggtccttggatcggataccgagttttca |
32059438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 141 - 279
Target Start/End: Original strand, 34310201 - 34310339
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||||||| ||||||| ||||| || ||||||||||| ||||| |||| | ||||| ||||||||| |
|
|
| T |
34310201 |
ggttcgattccctctggtgccaattttggtgggctaagtccatacagagcttgctctggctttaaacgggacccccataagtggacggtgggattggtcc |
34310300 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
34310301 |
cctcgaattaatcgattcttggatcggataccgagtttt |
34310339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 149 - 281
Target Start/End: Complemental strand, 19456340 - 19456209
Alignment:
| Q |
149 |
tccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcccctcggat |
248 |
Q |
| |
|
||||||| ||| |||||| ||||||||||||| ||||||| ||||| || |||||||||||||||| |||||| ||||||| ||||||||||||||||| |
|
|
| T |
19456340 |
tccctctggtgccaatttcggtgggctaagtccatacagagcttgctctggctttaaacggggcccc-gcaagtgggcggtgggattggtcccctcggat |
19456242 |
T |
 |
| Q |
249 |
taatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|| |||||| ||||||||||||||||||||||| |
|
|
| T |
19456241 |
tagtcgattcttggatcggataccgagttttca |
19456209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 141 - 281
Target Start/End: Original strand, 38684267 - 38684406
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| ||| |||||| ||||||||||||| ||||||| ||||| || ||||||||||| ||||||||||| |||||| ||||||||| |
|
|
| T |
38684267 |
ggttcgattccctctggtgccaatttcggtgggctaagtccatacagagcttgctctggctttaaacggg-cccccgcaagtgagcggtgggattggtcc |
38684365 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||||||| |||||| |||||||||||||||| |||||| |
|
|
| T |
38684366 |
cctcggattagtcgattcttggatcggataccgatttttca |
38684406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 141 - 279
Target Start/End: Complemental strand, 11926640 - 11926501
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggccccc-gcaagttggcggtgagattggtc |
239 |
Q |
| |
|
|||| |||||||||| ||| |||||| ||||||||||||| ||||||| ||||| || ||||||||||||||||| |||||| || |||| |||||||| |
|
|
| T |
11926640 |
ggttagattccctctggtgccaatttcggtgggctaagtccatacagagcttgctctggctttaaacggggccccccgcaagtgggtggtgggattggtc |
11926541 |
T |
 |
| Q |
240 |
ccctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
||||||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
11926540 |
ccctcggattagtcgattcttggatcggataccgagtttt |
11926501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 151 - 281
Target Start/End: Original strand, 35425082 - 35425212
Alignment:
| Q |
151 |
cctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcccctcggatta |
250 |
Q |
| |
|
||||||||| |||||| ||||||||||||| ||||||| | ||| || ||||||||||||||||||||||| ||||||| ||||||||| ||||||||| |
|
|
| T |
35425082 |
cctctagtgccaatttcggtgggctaagtccatacagagctcgctctggctttaaacggggcccccgcaagtgggcggtgggattggtcctctcggatta |
35425181 |
T |
 |
| Q |
251 |
atcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||| |||||||||||||||| |||||| |
|
|
| T |
35425182 |
gtcgattcttggatcggataccgaattttca |
35425212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 142 - 281
Target Start/End: Complemental strand, 31288083 - 31287944
Alignment:
| Q |
142 |
gttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtccc |
241 |
Q |
| |
|
|||||||||||| | ||| |||||| |||||| |||||| ||||| | |||||||||||||||||||||||||||||||| ||||||| |||||||| | |
|
|
| T |
31288083 |
gttcgattccctttggtgccaatttcggtgggttaagtccatacaaagcttgctttgactttaaacggggcccccgcaagtgggcggtgggattggtctc |
31287984 |
T |
 |
| Q |
242 |
ctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||| |||| ||| || ||||| ||||||||||||||||| |
|
|
| T |
31287983 |
ctcgaattagtcggttcttggaccggataccgagttttca |
31287944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 170 - 279
Target Start/End: Complemental strand, 13659354 - 13659245
Alignment:
| Q |
170 |
tgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcccctcggattaatcgattattggatcggat |
269 |
Q |
| |
|
|||| |||||| ||| |||| |||||||||||||||||||| ||||||||||| ||||||| ||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
13659354 |
tgggttaagtccatagagaacttgctttgactttaaacgggacccccgcaagtgggcggtgggattgatcccctcggattaatcgattcttggatcggat |
13659255 |
T |
 |
| Q |
270 |
accgagtttt |
279 |
Q |
| |
|
||||| |||| |
|
|
| T |
13659254 |
accgaatttt |
13659245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 142 - 281
Target Start/End: Complemental strand, 33709638 - 33709501
Alignment:
| Q |
142 |
gttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtccc |
241 |
Q |
| |
|
|||||||||||||| ||| |||||| ||||||||||||| ||||||| ||| || ||||||||||| ||||| ||||| ||||||| |||||||||| |
|
|
| T |
33709638 |
gttcgattccctctggtgccaatttcggtgggctaagtccatacagaga--gctctggctttaaacgggacccccacaagtgggcggtgggattggtccc |
33709541 |
T |
 |
| Q |
242 |
ctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| ||||||| |
|
|
| T |
33709540 |
ctcggattagtcgattcttggatcggataccgtgttttca |
33709501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 141 - 281
Target Start/End: Original strand, 37495106 - 37495253
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggccccc-------gcaagttggcggtgaga |
233 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||||||| ||||||| ||||| || ||||||||| ||||| |||||| ||||||| || |
|
|
| T |
37495106 |
ggttcgattccctctggtgccaattttggtgggctaagtccatacagagcttgctctggctttaaacgcccccccccccgcccgcaagtgggcggtggga |
37495205 |
T |
 |
| Q |
234 |
ttggtcccctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
||||||||||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
37495206 |
ttggtcccctcggattagtcgattcttggatcggataccgagttttca |
37495253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 141 - 253
Target Start/End: Complemental strand, 15971260 - 15971148
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||| ||||| ||||||||| ||||||||||||| ||||| | ||||| |||||||||||||| ||||||||||| ||||||||||||| ||| |
|
|
| T |
15971260 |
ggttcgatttcctctgatgtcaatttcggtgggctaagtccatacatagcttgctctgactttaaacgggacccccgcaagtgggcggtgagattgatcc |
15971161 |
T |
 |
| Q |
241 |
cctcggattaatc |
253 |
Q |
| |
|
||||||||||||| |
|
|
| T |
15971160 |
cctcggattaatc |
15971148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 142 - 281
Target Start/End: Original strand, 4603837 - 4603976
Alignment:
| Q |
142 |
gttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtccc |
241 |
Q |
| |
|
|||||||||| ||| ||| |||||| | ||||||||||| ||||||| | ||| || |||||||||||||||| |||||| | ||||| |||||||||| |
|
|
| T |
4603837 |
gttcgattccttctggtgccaatttcgatgggctaagtccatacagagctcgctctggctttaaacggggcccctgcaagtggacggtgggattggtccc |
4603936 |
T |
 |
| Q |
242 |
ctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
||||||||| ||| | ||||||||||||||||||||||| |
|
|
| T |
4603937 |
ctcggattagtcggtccttggatcggataccgagttttca |
4603976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 141 - 279
Target Start/End: Complemental strand, 6014418 - 6014280
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||| | ||| ||| |||||| |||||| |||||| ||||||| ||||| || |||||||||||| || ||||||| |||||||||||| |||| |
|
|
| T |
6014418 |
ggttcgattacttctggtgccaatttcggtgggttaagtccatacagagcttgctctggctttaaacggggtccacgcaagtgggcggtgagattagtcc |
6014319 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
||||| |||| |||||| |||||||||||| |||||||| |
|
|
| T |
6014318 |
cctcgaattagtcgattcttggatcggatatcgagtttt |
6014280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 201 - 279
Target Start/End: Original strand, 22693054 - 22693132
Alignment:
| Q |
201 |
tttaaacggggcccccgcaagttggcggtgagattggtcccctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
|||||||||||||||||||||| ||||||| ||||||||||||||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
22693054 |
tttaaacggggcccccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagtttt |
22693132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 141 - 274
Target Start/End: Complemental strand, 11465045 - 11464913
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||| ||||| ||| ||||||||||||||||||| ||||||| || || || |||||||||||||||| |||||| || |||| ||||||||| |
|
|
| T |
11465045 |
ggttcgatttcctctggtgccaattttggtgggctaagttcatacagagcttactctggctttaaacggggcccc-gcaagtgggtggtgggattggtcc |
11464947 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccga |
274 |
Q |
| |
|
||||| |||| |||||| |||||||||||||||| |
|
|
| T |
11464946 |
cctcgaattagtcgattcttggatcggataccga |
11464913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 141 - 281
Target Start/End: Complemental strand, 10869703 - 10869563
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||| ||| || |||||| ||||||||||||| | || || ||||| || ||||||| |||||| |||||||| ||||||| ||||||||| |
|
|
| T |
10869703 |
ggttcgattccatctggttccaatttcggtgggctaagtccacactgagcttgctctggctttaaatggggcctccgcaagtgggcggtgggattggtcc |
10869604 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||||||| ||| || |||||||||||||| |||||||| |
|
|
| T |
10869603 |
cctcggattagtcggttcttggatcggataccaagttttca |
10869563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 210 - 281
Target Start/End: Complemental strand, 38631048 - 38630977
Alignment:
| Q |
210 |
ggcccccgcaagttggcggtgagattggtcccctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
||||||||||||| ||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
38631048 |
ggcccccgcaagtgggcggtgggattggtcccctcggattaatcgattcttggatcggataccgagttttca |
38630977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 191 - 281
Target Start/End: Original strand, 22392797 - 22392887
Alignment:
| Q |
191 |
ttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcccctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
||||| || ||||||||||||||||||||||| ||||||| |||||||||||| ||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
22392797 |
ttgctctggctttaaacggggcccccgcaagtgggcggtggaattggtcccctcagattagtcgatttttggatcggataccgagttttca |
22392887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 161 - 279
Target Start/End: Complemental strand, 23270640 - 23270522
Alignment:
| Q |
161 |
caattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcccctcggattaatcgattatt |
260 |
Q |
| |
|
|||||| ||||||||||||| ||||||| |||||||| |||||||||| |||||||||| | | ||||| ||||||||||||||||||| | |||| || |
|
|
| T |
23270640 |
caatttcggtgggctaagtccatacagagcttgctttggctttaaacggagcccccgcaaatggacggtgggattggtcccctcggattagttgattctt |
23270541 |
T |
 |
| Q |
261 |
ggatcggataccgagtttt |
279 |
Q |
| |
|
|||| ||||||| |||||| |
|
|
| T |
23270540 |
ggattggataccaagtttt |
23270522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 141 - 279
Target Start/End: Complemental strand, 19145549 - 19145412
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaa-tttgctttgactttaaacggggcccccgcaagttggcggtgagattggtc |
239 |
Q |
| |
|
||||||||||||||| ||| |||||| ||||||| ||||| ||||||| |||||| || ||||||| || ||||||||||| ||||||| |||||||| |
|
|
| T |
19145549 |
ggttcgattccctctggtgccaatttcggtgggc-aagtccatacagagctttgctctggctttaaatggt-cccccgcaagtgggcggtgggattggtc |
19145452 |
T |
 |
| Q |
240 |
ccctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
||||||||||| | | || ||||||||||||||||||||| |
|
|
| T |
19145451 |
ccctcggattagttggttcttggatcggataccgagtttt |
19145412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 141 - 271
Target Start/End: Complemental strand, 13038592 - 13038463
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| ||| |||||||| |||||||||| ||||||| | | || ||||||||||||||||||||||| ||||||| ||||| ||| |
|
|
| T |
13038592 |
ggttcgattccctctggtgccaattttgatgggctaagttcatacagagcaag-tatggctttaaacggggcccccgcaagtgggcggtgggattgatcc |
13038494 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggatac |
271 |
Q |
| |
|
||||| |||| |||||| ||||||||||||| |
|
|
| T |
13038493 |
cctcgaattagtcgattcttggatcggatac |
13038463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 141 - 271
Target Start/End: Complemental strand, 13108587 - 13108458
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| ||| |||||||| |||||||||| ||||||| | | || ||||||||||||||||||||||| ||||||| ||||| ||| |
|
|
| T |
13108587 |
ggttcgattccctctggtgccaattttgatgggctaagttcatacagagcaag-tctgcctttaaacggggcccccgcaagtgggcggtgggattgatcc |
13108489 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggatac |
271 |
Q |
| |
|
||||| |||| |||||| ||||||||||||| |
|
|
| T |
13108488 |
cctcgaattagtcgattcttggatcggatac |
13108458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 191 - 281
Target Start/End: Complemental strand, 41351191 - 41351102
Alignment:
| Q |
191 |
ttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcccctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
||||| || ||||||||||||| || |||||| ||||||| ||||||||||||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
41351191 |
ttgctctggctttaaacggggctcc-gcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagttttca |
41351102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 141 - 281
Target Start/End: Complemental strand, 12398586 - 12398446
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||| | |||||||||| ||||| |||||| ||||||| ||||| || ||||||| ||||||||||||| | | ||||||||||| ||| |
|
|
| T |
12398586 |
ggttcgattccctatggtgtcaatttcggtggcctaagttcatacagagcttgctctggctttaaatggggcccccgcaaatggacggtgagattgatcc |
12398487 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
||| |||| ||| || |||||| |||||||||||||||| |
|
|
| T |
12398486 |
tctcaaattagtcggttcttggattggataccgagttttca |
12398446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 160 - 279
Target Start/End: Complemental strand, 9659430 - 9659311
Alignment:
| Q |
160 |
tcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcccctcggattaatcgattat |
259 |
Q |
| |
|
||||||| ||||||||||||| ||||| | ||||| || ||||||| ||| ||||||||||| | ||||| |||||||||| |||||||| | |||| | |
|
|
| T |
9659430 |
tcaatttcggtgggctaagtccatacacagcttgctctggctttaaatgggccccccgcaagtggacggtgggattggtcccttcggattagttgattct |
9659331 |
T |
 |
| Q |
260 |
tggatcggataccgagtttt |
279 |
Q |
| |
|
||||| |||||||||||||| |
|
|
| T |
9659330 |
tggatgggataccgagtttt |
9659311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 161 - 279
Target Start/End: Complemental strand, 27487673 - 27487554
Alignment:
| Q |
161 |
caattttggtgggctaagtcaatacagaatttgctttgactttaaacggggccccc-gcaagttggcggtgagattggtcccctcggattaatcgattat |
259 |
Q |
| |
|
|||||| ||||| ||||||| ||||||| ||||| | |||||||||||| ||| |||||| ||||||| ||||||||||||||||||| |||||| | |
|
|
| T |
27487673 |
caatttcggtggactaagtccatacagagcttgctctagctttaaacgggggcccttgcaagtgggcggtgggattggtcccctcggattagtcgattct |
27487574 |
T |
 |
| Q |
260 |
tggatcggataccgagtttt |
279 |
Q |
| |
|
|||||||||||| ||||||| |
|
|
| T |
27487573 |
tggatcggatacagagtttt |
27487554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 168 - 279
Target Start/End: Original strand, 34049897 - 34050008
Alignment:
| Q |
168 |
ggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcccctcggattaatcgattattggatcgg |
267 |
Q |
| |
|
||||||||||||| ||||||| ||||| || ||||||||||||||||||||||| | |||| ||||||||||||||||||| | |||| | ||||| |
|
|
| T |
34049897 |
ggtgggctaagtccatacagagcttgctctggctttaaacggggcccccgcaagtggtcggtaggattggtcccctcggattagttgattctcaaatcgg |
34049996 |
T |
 |
| Q |
268 |
ataccgagtttt |
279 |
Q |
| |
|
|||||||||||| |
|
|
| T |
34049997 |
ataccgagtttt |
34050008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 135 - 281
Target Start/End: Complemental strand, 26009408 - 26009262
Alignment:
| Q |
135 |
gtttcgggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagat |
234 |
Q |
| |
|
||||| ||||||||||||| | ||| |||||| |||||||||||| || |||| || || || ||||||||||||||||||||||| || ||| ||| |
|
|
| T |
26009408 |
gtttccggttcgattccctttggtgccaatttcagtgggctaagtccatgcagagcttactctggctttaaacggggcccccgcaagtgggtagtgggat |
26009309 |
T |
 |
| Q |
235 |
tggtcccctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
| |||||||||||||| ||| || ||| |||| ||| |||||||||| |
|
|
| T |
26009308 |
tagtcccctcggattagtcggttcttgaatcgaatatcgagttttca |
26009262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 141 - 270
Target Start/End: Original strand, 42193544 - 42193671
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||| ||||| || |||||| ||||||||||||| ||||||| ||||||||| ||||||| || |||||||||| ||||||| | ||||||| |
|
|
| T |
42193544 |
ggttcgatttcctctgatgccaatttcggtgggctaagtctatacagagtttgctttggctttaaa--tggaccccgcaagtgggcggtggggttggtcc |
42193641 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggata |
270 |
Q |
| |
|
||||||||| |||||| ||||||| |||| |
|
|
| T |
42193642 |
tctcggattagtcgattcttggatcagata |
42193671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 141 - 281
Target Start/End: Complemental strand, 41569006 - 41568867
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||| ||||| |||||||||| ||||| ||||||| |||||||||||| |||| ||||||| || |||||||| | || |||| ||||||||| |
|
|
| T |
41569006 |
ggttcgatttcctcttgtgtcaatttcggtggactaagtccatacagaatttgttttgtctttaaa-tggaaccccgcaaatgggtggtgggattggtcc |
41568908 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
||| ||||| | ||||||| |||| |||| |||||||||| |
|
|
| T |
41568907 |
cctaagattagttgattattcgatcagatatcgagttttca |
41568867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 141 - 271
Target Start/End: Original strand, 36954877 - 36955007
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| || ||||| || | |||||||| ||||||| ||||||||| ||||||| ||| ||||||||||| | | ||| |||| |||| |
|
|
| T |
36954877 |
ggttcgattccctctggttctaatttcggcgtgctaagtccatacagagtttgctttggctttaaatgggccccccgcaagtggactgtgggattagtcc |
36954976 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggatac |
271 |
Q |
| |
|
|||| |||| |||||| ||||||||||||| |
|
|
| T |
36954977 |
cctcatattagtcgattcttggatcggatac |
36955007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 138 - 281
Target Start/End: Complemental strand, 12317291 - 12317153
Alignment:
| Q |
138 |
tcgggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattgg |
237 |
Q |
| |
|
||||||| |||| | ||| |||||||||| |||||| |||||| |||| ||||| ||||||||| |||| ||||||||||| || |||| ||||| |
|
|
| T |
12317291 |
tcgggtttgatttcatctggtgtcaatttcggtgggttaagtc----cagagcttgctctgactttaagcgggccccccgcaagtgggtggtgggattga |
12317196 |
T |
 |
| Q |
238 |
tcccctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||| |||||||| || ||| || |||||||||||||||||||| |
|
|
| T |
12317195 |
tccc-tcggattagtcaattcttagatcggataccgagttttca |
12317153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 232 - 281
Target Start/End: Complemental strand, 10631336 - 10631287
Alignment:
| Q |
232 |
gattggtcccctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
10631336 |
gattggtcccctcggattagtcgattcttggatcggataccgagttttca |
10631287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 136 - 279
Target Start/End: Original strand, 10399827 - 10399971
Alignment:
| Q |
136 |
tttcgggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagatt |
235 |
Q |
| |
|
|||| |||| ||||| |||| | | |||||| | ||||||||||| |||| || |||| ||||||||||||||||||||| |||| | ||||| |||| |
|
|
| T |
10399827 |
tttcaggtttgattctctctggcgccaatttcgatgggctaagtccatacggagcatgctctgactttaaacggggcccccgtaagtggacggtgggatt |
10399926 |
T |
 |
| Q |
236 |
ggtc-ccctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
|||| |||||| |||| |||||| ||||||| ||| |||||||| |
|
|
| T |
10399927 |
ggtcaccctcgaattagtcgattcttggatcaaatagcgagtttt |
10399971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 147 - 279
Target Start/End: Complemental strand, 25750741 - 25750613
Alignment:
| Q |
147 |
attccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcccctcgg |
246 |
Q |
| |
|
||||| ||| ||| |||||| |||||| |||||| ||| ||| ||||| || ||| |||||| ||||| |||| || ||||||||||||||| || | |
|
|
| T |
25750741 |
attccttctggtgccaatttcggtgggttaagtccatatagagcttgctctggctt--aacgggaccccc--aagtggggggtgagattggtcccttcag |
25750646 |
T |
 |
| Q |
247 |
attaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
|||| |||||| ||||||||||||||||||||| |
|
|
| T |
25750645 |
attagtcgattcttggatcggataccgagtttt |
25750613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 147 - 279
Target Start/End: Original strand, 5049202 - 5049333
Alignment:
| Q |
147 |
attccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcccctcgg |
246 |
Q |
| |
|
||||||||| || |||||| | ||| |||||| ||||||| ||||| || ||||||||||| ||||||||| | | ||||| |||||||||| ||| |
|
|
| T |
5049202 |
attccctctggtaccaatttcgatggtctaagttcatacagagcttgctctggctttaaacggg-cccccgcaaatggacggtgggattggtcccatcga |
5049300 |
T |
 |
| Q |
247 |
attaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
|||| |||||| |||||||| ||||| |||||| |
|
|
| T |
5049301 |
attagtcgattcttggatcgaataccaagtttt |
5049333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 213 - 268
Target Start/End: Original strand, 5067392 - 5067447
Alignment:
| Q |
213 |
ccccgcaagttggcggtgagattggtcccctcggattaatcgattattggatcgga |
268 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||| ||||| |||||| |||||||||| |
|
|
| T |
5067392 |
ccccgcaagtgggcggtgggattggtcccctctgattagtcgattcttggatcgga |
5067447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 141 - 279
Target Start/End: Complemental strand, 24158304 - 24158166
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaa-tttgctttgactttaaacggggcccccgcaagttggcggtgagattggtc |
239 |
Q |
| |
|
||||||||||| ||| |||||||||| | |||| |||||| ||||| | ||| || || ||| ||||||||| | |||||| |||||||||||||||| |
|
|
| T |
24158304 |
ggttcgattccttctggtgtcaatttcgatggg-taagtccatacatagctttactctggcttagaacggggcctctgcaagtgggcggtgagattggtc |
24158206 |
T |
 |
| Q |
240 |
ccctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
||||| ||||| ||| | ||| |||||||||||| |||| |
|
|
| T |
24158205 |
ccctcagattagtcggtccttgaatcggataccgaatttt |
24158166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 218 - 281
Target Start/End: Original strand, 33737878 - 33737940
Alignment:
| Q |
218 |
caagttggcggtgagattggtcccctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||| | |||| ||| ||||||||||||||||||| |
|
|
| T |
33737878 |
caagtgggcggtgagattggtcccctcgg-ttagttgattcttgaatcggataccgagttttca |
33737940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 226 - 279
Target Start/End: Complemental strand, 28614539 - 28614486
Alignment:
| Q |
226 |
cggtgagattggtcccctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
||||| ||||| |||||||| |||| |||||| ||||||||||||||||||||| |
|
|
| T |
28614539 |
cggtgggattgatcccctcgaattagtcgatttttggatcggataccgagtttt |
28614486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 205 - 281
Target Start/End: Original strand, 37972906 - 37972982
Alignment:
| Q |
205 |
aacggggcccccgcaagttggcggtgagattggtcccctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
||||| || ||||||||| ||| ||||||||| |||||||| ||||||||| || ||||| |||||||||||||| |
|
|
| T |
37972906 |
aacggagctcccgcaagtgggcagtgagattgatcccctcgaattaatcgacccttagatcgaataccgagttttca |
37972982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 205 - 280
Target Start/End: Complemental strand, 21377323 - 21377248
Alignment:
| Q |
205 |
aacggggcccccgcaagttggcggtgagattggtcccctcggattaatcgattattggatcggataccgagttttc |
280 |
Q |
| |
|
||||||||| | |||||| || ||||||||||||| | | |||||| ||| | |||||||||||||||||||||| |
|
|
| T |
21377323 |
aacggggcctctgcaagtgggtggtgagattggtctctttggattagtcggtctttggatcggataccgagttttc |
21377248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 214 - 281
Target Start/End: Complemental strand, 25548599 - 25548532
Alignment:
| Q |
214 |
cccgcaagttggcggtgagattggtcccctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
||||||||| |||||| |||||||| |||| |||| |||||| |||||||| |||||||||||||| |
|
|
| T |
25548599 |
cccgcaagtacgcggtgggattggtcatctcgaattagtcgattcttggatcgaataccgagttttca |
25548532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 141 - 216
Target Start/End: Original strand, 25586991 - 25587066
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggccccc |
216 |
Q |
| |
|
||||||||| ||||| ||| |||||| ||||||||||||| ||||||| ||||| || |||||||| || ||||| |
|
|
| T |
25586991 |
ggttcgatttcctctggtgccaatttcggtgggctaagtccatacagagcttgctctggctttaaacaggaccccc |
25587066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 231 - 281
Target Start/End: Complemental strand, 3600046 - 3599996
Alignment:
| Q |
231 |
agattggtcccctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||| ||||||||||||| |||||| ||||||| ||||||||| ||||| |
|
|
| T |
3600046 |
agattgatcccctcggattagtcgattcttggatctgataccgagatttca |
3599996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 233 - 279
Target Start/End: Original strand, 7151454 - 7151500
Alignment:
| Q |
233 |
attggtcccctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
||||||||||| | |||| |||||| ||||||||||||||||||||| |
|
|
| T |
7151454 |
attggtcccctagaattagtcgattcttggatcggataccgagtttt |
7151500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 141 - 235
Target Start/End: Original strand, 15931118 - 15931211
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagatt |
235 |
Q |
| |
|
||||||||||||||| ||| |||||| ||| ||||||||| ||||||| |||| || |||||||| |||| | ||||||| ||||||| |||| |
|
|
| T |
15931118 |
ggttcgattccctctggtgccaatttcggt-ggctaagtccatacagagcctgctctggctttaaacagggctctcgcaagtgggcggtgggatt |
15931211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 318 - 355
Target Start/End: Original strand, 39787241 - 39787278
Alignment:
| Q |
318 |
ctaatcaagctactaactctagttaacctatcaactaa |
355 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
39787241 |
ctaaccaagctactaactctagtttacctatcaactaa |
39787278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 211 - 279
Target Start/End: Complemental strand, 930554 - 930486
Alignment:
| Q |
211 |
gcccccgcaagttggcggtgagattggtcccctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
|||| ||||||| | | ||| ||||||||||||||||||| ||| | |||||||||||| |||||||| |
|
|
| T |
930554 |
gccctcgcaagtggacagtgtgattggtcccctcggattagtcggtccttggatcggatatcgagtttt |
930486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 243 - 279
Target Start/End: Original strand, 9100302 - 9100338
Alignment:
| Q |
243 |
tcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
|||||||| | |||||||||||||||||||||||||| |
|
|
| T |
9100302 |
tcggattagttgattattggatcggataccgagtttt |
9100338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 141 - 177
Target Start/End: Complemental strand, 17028273 - 17028237
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaa |
177 |
Q |
| |
|
|||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
17028273 |
ggtttgattccctctagtgtcaatttaggtgggctaa |
17028237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 215 - 279
Target Start/End: Original strand, 36895558 - 36895622
Alignment:
| Q |
215 |
ccgcaagttggcggtgagattggtcccctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
|||||||| ||||| | ||||| || ||||| |||| ||| || ||||||||||||||||||||| |
|
|
| T |
36895558 |
ccgcaagtgggcggggggattgttctcctcgaattagtcggttcttggatcggataccgagtttt |
36895622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 93; Significance: 3e-45; HSPs: 53)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 141 - 281
Target Start/End: Original strand, 4718708 - 4718848
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| ||| |||||| ||||||||||||| ||||||| ||||| || ||||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
4718708 |
ggttcgattccctctggtgccaatttcggtgggctaagtccatacagagcttgctctggctttaaacggggcccccgcaagtgggcggtgggattggtcc |
4718807 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
4718808 |
cctcggattagtcgattcttggatcggataccgagttttca |
4718848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 89; E-Value: 8e-43
Query Start/End: Original strand, 141 - 281
Target Start/End: Complemental strand, 34237793 - 34237653
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| ||| |||||| ||||||||||||| ||||||| ||||| || ||||||||||||||||||||||| |||||| ||||||||| |
|
|
| T |
34237793 |
ggttcgattccctctggtgccaatttcggtgggctaagtccatacagagcttgctctggctttaaacggggcccccgcaagtgagcggtgggattggtcc |
34237694 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
34237693 |
cctcggattagtcgattcttggatcggataccgagttttca |
34237653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 141 - 281
Target Start/End: Complemental strand, 3734761 - 3734621
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| ||| |||||| ||||||||||||| ||||||| ||||| || ||||||||||||||||||||| | ||| ||| ||||||||| |
|
|
| T |
3734761 |
ggttcgattccctctggtgccaatttcggtgggctaagtccatacagagcttgctctggctttaaacggggcccccgcaaatgggcagtgggattggtcc |
3734662 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
3734661 |
cctcggattagtcgattcttggatcggataccgagttttca |
3734621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 141 - 281
Target Start/End: Complemental strand, 8765664 - 8765524
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| ||| |||||| | ||||||||||| ||||||| ||||| || ||||||||||||| ||||||||| ||||||| ||||||||| |
|
|
| T |
8765664 |
ggttcgattccctctggtgccaatttcgatgggctaagtccatacagagcttgctctggctttaaacggggctcccgcaagtgggcggtgggattggtcc |
8765565 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
8765564 |
cctcggattagtcgattcttggatcggataccgagttttca |
8765524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 141 - 281
Target Start/End: Original strand, 39349319 - 39349459
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| ||| |||||| ||||||||||||| ||||||| ||||| || ||||||||||||||||||||||| ||||||| ||||| ||| |
|
|
| T |
39349319 |
ggttcgattccctctggtgccaatttcggtgggctaagtccatacagagcttgctctggctttaaacggggcccccgcaagtgggcggtgggattgatcc |
39349418 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||||||| |||||| |||||||||||||| |||||||| |
|
|
| T |
39349419 |
cctcggattagtcgattcttggatcggataccaagttttca |
39349459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 141 - 279
Target Start/End: Original strand, 21603293 - 21603431
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||| | ||| |||||| ||||||||||| | ||||||| ||||| || ||||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
21603293 |
ggttcgattccctatggtgccaatttcggtgggctaagcccatacagagcttgctctggctttaaacggggcccccgcaagtgggcggtgggattggtcc |
21603392 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
21603393 |
cctcggattagtcgattcttggatcggataccgagtttt |
21603431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 140 - 281
Target Start/End: Original strand, 2618248 - 2618389
Alignment:
| Q |
140 |
gggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtc |
239 |
Q |
| |
|
|||||||||||||||| ||| |||||| |||||||||||| ||||||| ||||| || |||||||||| |||||||||||| ||||||| |||||||| |
|
|
| T |
2618248 |
gggttcgattccctctggtgccaatttcagtgggctaagtccatacagagcttgctctggctttaaacggagcccccgcaagtgggcggtgggattggtc |
2618347 |
T |
 |
| Q |
240 |
ccctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
||||||||||| |||||| ||||||||||| ||||||||||| |
|
|
| T |
2618348 |
ccctcggattagtcgattcttggatcggattccgagttttca |
2618389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 141 - 281
Target Start/End: Original strand, 32879342 - 32879482
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| ||| |||||| |||||||||||| ||||||| ||||| |||| ||||||||||||||| ||||| ||||||| ||||||||| |
|
|
| T |
32879342 |
ggttcgattccctctggtgccaatttcggtgggctaagttcatacagagcttgctctgacattaaacggggcccccacaagtgggcggtgggattggtcc |
32879441 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||||||| |||||| |||||| |||||||||||||||| |
|
|
| T |
32879442 |
cctcggattagtcgattcttggattggataccgagttttca |
32879482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 141 - 279
Target Start/End: Complemental strand, 6953145 - 6953008
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| ||| |||||| ||||||||||||| ||||||| ||||| || |||||||| |||||||||||||||||||||| ||||||| | |
|
|
| T |
6953145 |
ggttcgattccctctggtgccaatttcggtgggctaagtccatacagagcttgctctggctttaaacagggcccccgcaagttggcggtgggattggt-c |
6953047 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
|||||||||| |||||| |||||||| |||||||||||| |
|
|
| T |
6953046 |
cctcggattagtcgattcttggatcgaataccgagtttt |
6953008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 141 - 278
Target Start/End: Complemental strand, 15259544 - 15259407
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| ||| |||||| ||||||||||||| ||||||| ||||| || ||||||||||||||||||||||| ||||||| |||||||| |
|
|
| T |
15259544 |
ggttcgattccctctggtgccaatttcggtgggctaagtccatacagagcttgctctggctttaaacggggcccccgcaagtgggcggtgtaattggtcc |
15259445 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttt |
278 |
Q |
| |
|
||||| |||| |||||| ||||||||||| |||||||| |
|
|
| T |
15259444 |
cctcgaattagtcgattcttggatcggatgccgagttt |
15259407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 141 - 278
Target Start/End: Original strand, 28193537 - 28193674
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| ||| |||||| |||||| |||||| ||||||| ||||| || |||||||||||||||| ||||| ||||||| ||||||||| |
|
|
| T |
28193537 |
ggttcgattccctctggtgccaatttcggtgggttaagtccatacagagcttgctctggctttaaacggggcccctacaagtgggcggtgggattggtcc |
28193636 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttt |
278 |
Q |
| |
|
|||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
28193637 |
cctcggattagtcgattcttggatcggataccgagttt |
28193674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 141 - 281
Target Start/End: Complemental strand, 4698861 - 4698721
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| |||||||||| ||||||||||||| || |||| ||||| || |||||||||| |||||||||||| |||||| ||||||||| |
|
|
| T |
4698861 |
ggttcgattccctctggtgtcaatttcggtgggctaagtccatgaagaacttgctctggctttaaacggagcccccgcaagtgagcggtgggattggtcc |
4698762 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||||||| |||||| ||||| |||||||||||||||| |
|
|
| T |
4698761 |
cctcggattagtcgattcatggattggataccgagttttca |
4698721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 143 - 279
Target Start/End: Complemental strand, 42643254 - 42643118
Alignment:
| Q |
143 |
ttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcccc |
242 |
Q |
| |
|
||||||||||||||||| |||||| ||||||||||||| ||||||| ||||| || ||| |||||||| |||||||||| ||||||| ||||||||||| |
|
|
| T |
42643254 |
ttcgattccctctagtgccaatttcggtgggctaagtccatacagagcttgctctgtcttgaaacgggggccccgcaagtgggcggtgggattggtcccc |
42643155 |
T |
 |
| Q |
243 |
tcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
||| |||| | |||| ||||||||||||||||||||| |
|
|
| T |
42643154 |
tcgcattagttgattcttggatcggataccgagtttt |
42643118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 143 - 281
Target Start/End: Original strand, 20305973 - 20306111
Alignment:
| Q |
143 |
ttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcccc |
242 |
Q |
| |
|
||||||||| ||| ||| |||||| | ||||||||||| ||||||| ||||| || ||||||||||| ||||||||||| ||||||| ||||||||||| |
|
|
| T |
20305973 |
ttcgattccttctggtgccaatttcgatgggctaagtccatacagagcttgctctggctttaaacgggacccccgcaagtgggcggtgggattggtcccc |
20306072 |
T |
 |
| Q |
243 |
tcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
||| |||| ||||| ||||||||||||||||||||||| |
|
|
| T |
20306073 |
tcgaattagtcgatccttggatcggataccgagttttca |
20306111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 143 - 281
Target Start/End: Original strand, 21092606 - 21092744
Alignment:
| Q |
143 |
ttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcccc |
242 |
Q |
| |
|
||||||||| ||| ||| |||||| | ||||||||||| ||||||| ||||| || ||||||||||| ||||||||||| ||||||| ||||||||||| |
|
|
| T |
21092606 |
ttcgattccttctggtgccaatttcgatgggctaagtccatacagagcttgctctggctttaaacgggacccccgcaagtgggcggtgggattggtcccc |
21092705 |
T |
 |
| Q |
243 |
tcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
||| |||| ||||| ||||||||||||||||||||||| |
|
|
| T |
21092706 |
tcgaattagtcgatccttggatcggataccgagttttca |
21092744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 141 - 279
Target Start/End: Original strand, 25248412 - 25248547
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| |||||||||| ||| |||||||||| |||||| |||||| || ||||||||||| ||| ||||||| ||||||| ||||||||| |
|
|
| T |
25248412 |
ggttcgattccctctggtgtcaatttcggtaggctaagtca-tacagagtttgctctggctttaaacggg-ccctcgcaagtgggcggtgggattggtcc |
25248509 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
|||||||||| |||||| || |||||||||||||||||| |
|
|
| T |
25248510 |
cctcggattagtcgatt-tttgatcggataccgagtttt |
25248547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 141 - 281
Target Start/End: Original strand, 19471672 - 19471813
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccc-cgcaagttggcggtgagattggtc |
239 |
Q |
| |
|
|||| |||||||||| ||| ||||||||||| |||||||| ||||||| ||||| || |||||||||||||||| ||||||| |||| || |||||||| |
|
|
| T |
19471672 |
ggtttgattccctctggtgccaattttggtgagctaagtccatacagagcttgctctggctttaaacggggccccccgcaagtgggcgatgggattggtc |
19471771 |
T |
 |
| Q |
240 |
ccctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||| |||| ||||| ||||||||||||||||||||||| |
|
|
| T |
19471772 |
ccctcgaattagtcgatacttggatcggataccgagttttca |
19471813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 141 - 281
Target Start/End: Original strand, 19542596 - 19542737
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccc-cgcaagttggcggtgagattggtc |
239 |
Q |
| |
|
|||| |||||||||| ||| ||||||||||| |||||||| ||||||| ||||| || |||||||||||||||| ||||||| |||| || |||||||| |
|
|
| T |
19542596 |
ggtttgattccctctggtgccaattttggtgagctaagtccatacagagcttgctctggctttaaacggggccccccgcaagtgggcgatgggattggtc |
19542695 |
T |
 |
| Q |
240 |
ccctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||| |||| ||||| ||||||||||||||||||||||| |
|
|
| T |
19542696 |
ccctcgaattagtcgatacttggatcggataccgagttttca |
19542737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 141 - 281
Target Start/End: Complemental strand, 19590100 - 19589959
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggccccc-gcaagttggcggtgagattggtc |
239 |
Q |
| |
|
|||| |||||||||| ||| ||||||||||| |||||||| ||||||| ||||| || ||||||||||||||||| |||||| |||| || |||||||| |
|
|
| T |
19590100 |
ggtttgattccctctggtgccaattttggtgagctaagtccatacagagcttgctctggctttaaacggggccccccgcaagtgggcgatgggattggtc |
19590001 |
T |
 |
| Q |
240 |
ccctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||| |||| ||||| ||||||||||||||||||||||| |
|
|
| T |
19590000 |
ccctcgaattagtcgatacttggatcggataccgagttttca |
19589959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 141 - 281
Target Start/End: Original strand, 42328067 - 42328207
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
|||| |||||||||| || |||||| ||||||||||||| ||||||| ||||| || ||||||||||||||||| ||||| | || || ||||||||| |
|
|
| T |
42328067 |
ggtttgattccctctgttgccaatttcggtgggctaagtccatacagagcttgctctggctttaaacggggcccccacaagtggacgatgggattggtcc |
42328166 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
||||| |||| |||||| ||||||||||||||||||||||| |
|
|
| T |
42328167 |
cctcgaattagtcgattcttggatcggataccgagttttca |
42328207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 190 - 281
Target Start/End: Complemental strand, 2639500 - 2639409
Alignment:
| Q |
190 |
tttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcccctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||| || ||||||||||||||||||||||| ||||||| ||||||||||||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
2639500 |
tttgctctggctttaaacggggcccccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagttttca |
2639409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 141 - 279
Target Start/End: Complemental strand, 264537 - 264400
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||||||||| ||||| | ||||| || ||||||||||| ||||| ||| | ||||||||||||| ||| |
|
|
| T |
264537 |
ggttcgattccctctagtgccaatttcggtgggctaagtctatacatagcttgctctggctttaaacggg-cccccacaaatgggcggtgagattgatcc |
264439 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
||||| |||| |||||| |||||||||||||||| |||| |
|
|
| T |
264438 |
cctcgaattagtcgattcttggatcggataccgaatttt |
264400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 141 - 279
Target Start/End: Original strand, 651384 - 651521
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||||||||| ||||| | ||||| || |||||||| |||||||| ||| | ||||||||||||| ||| |
|
|
| T |
651384 |
ggttcgattccctctagtgccaatttcggtgggctaagtctatacatagcttgctctggctttaaac-gggcccccacaaatgggcggtgagattgatcc |
651482 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
||||| |||| |||||| |||||||||||||||| |||| |
|
|
| T |
651483 |
cctcgaattagtcgattcttggatcggataccgaatttt |
651521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 141 - 279
Target Start/End: Original strand, 837119 - 837256
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||||||||| ||||| | ||||| || |||||||| |||||||| ||| | ||||||||||||| ||| |
|
|
| T |
837119 |
ggttcgattccctctagtgccaatttcggtgggctaagtctatacatagcttgctctggctttaaac-gggcccccacaaatgggcggtgagattgatcc |
837217 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
||||| |||| |||||| |||||||||||||||| |||| |
|
|
| T |
837218 |
cctcgaattagtcgattcttggatcggataccgaatttt |
837256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 141 - 279
Target Start/End: Original strand, 20469980 - 20470117
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||||| | |||||| | ||||||||||| ||||||| ||||| || |||||||| | |||||||||||| ||||||| ||||||| |
|
|
| T |
20469980 |
ggttcgattccctctagagccaatttagatgggctaagtccatacagagcttgctctggctttaaacagagcccccgcaagtgggcggtgggattggt-t |
20470078 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
20470079 |
cctcggattagtcgatttttggatcggataccgagtttt |
20470117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 141 - 281
Target Start/End: Original strand, 14633017 - 14633157
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| ||| |||||| ||||||||||||| ||||||| ||||| || |||| ||||| || || ||||| ||||||| ||||||||| |
|
|
| T |
14633017 |
ggttcgattccctctggtgccaatttcggtgggctaagtctatacagagcttgctctggctttgaacggagcgtccacaagtgggcggtgggattggtcc |
14633116 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
||| |||||| |||||| |||||||||||||| |||||||| |
|
|
| T |
14633117 |
ccttggattagtcgattcttggatcggataccaagttttca |
14633157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 141 - 281
Target Start/End: Complemental strand, 34610825 - 34610685
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| || |||||| ||||| ||||||| ||||||| ||||| || ||||||||| | ||| ||||||| |||||| |||||||| |
|
|
| T |
34610825 |
ggttcgattccctctgatgccaatttcggtggtctaagtctatacagagcttgctctggctttaaacgagcccctcgcaagtgggcggtagaattggtcc |
34610726 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
||||| |||| |||||| ||||||||||||||||||||||| |
|
|
| T |
34610725 |
cctcgaattagtcgattcttggatcggataccgagttttca |
34610685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 143 - 270
Target Start/End: Original strand, 28088351 - 28088478
Alignment:
| Q |
143 |
ttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcccc |
242 |
Q |
| |
|
||||||||||| | |||||||||| |||||| |||||| ||||||| ||||| |||||||||| |||||| |||||||| ||||||| ||||| ||||| |
|
|
| T |
28088351 |
ttcgattccctttggtgtcaatttcggtgggttaagtccatacagagcttgctctgactttaaatggggcctccgcaagtgggcggtgggattgatcccc |
28088450 |
T |
 |
| Q |
243 |
tcggattaatcgattattggatcggata |
270 |
Q |
| |
|
|| || || |||||| |||||||||||| |
|
|
| T |
28088451 |
tcagaatagtcgattcttggatcggata |
28088478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 136 - 281
Target Start/End: Original strand, 1219407 - 1219552
Alignment:
| Q |
136 |
tttcgggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagatt |
235 |
Q |
| |
|
|||| ||||||||||||||| | ||||||| |||||||||||| |||||||||||| | || ||||||||||||||||| |||| |||||| ||| |
|
|
| T |
1219407 |
tttcaggttcgattccctctgatatcaatttcagtgggctaagtccatacagaatttgttctggctttaaacggggcccccataagtgggcggtaggatc |
1219506 |
T |
 |
| Q |
236 |
ggtcccctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||| |||||||| |||||| || ||||| ||||||| |||||| |
|
|
| T |
1219507 |
ggtcccttcggattagtcgattcttagatcgaataccgaattttca |
1219552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 141 - 281
Target Start/End: Original strand, 24018445 - 24018586
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggc-ccccgcaagttggcggtgagattggtc |
239 |
Q |
| |
|
||||||||| |||||| ||||||||| |||||||||||| ||||||| ||||| || ||||||||||| | |||| ||||| |||||||||||||||| |
|
|
| T |
24018445 |
ggttcgatttcctctaatgtcaatttcagtgggctaagtccatacagagcttgctctggctttaaacgggcctccccacaagtgggcggtgagattggtc |
24018544 |
T |
 |
| Q |
240 |
ccctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||| | |||| ||| || ||||| |||||| |||||||||| |
|
|
| T |
24018545 |
cccttgaattagtcggttcttggaccggatatcgagttttca |
24018586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 141 - 281
Target Start/End: Original strand, 18532170 - 18532301
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||||| |||||||| ||||| || ||||||||||||||| |||||| |||||||||||| |
|
|
| T |
18532170 |
ggttcgattccctcagatgtcaatttcggtgggctaagtccatacagaacttgctctggatttaaacggggcccctgcaagtgggcggtgagatt----- |
18532264 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
18532265 |
----ggattagtcgattcttggatcggataccgagttttca |
18532301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 141 - 279
Target Start/End: Original strand, 10292118 - 10292255
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| || |||||| ||||||| |||| || |||| ||||| || ||||||||||||||||| ||||| ||||||| ||||||||| |
|
|
| T |
10292118 |
ggttcgattccctctgatgccaatttcagtgggctgagtccat-cagagattgctctggctttaaacggggcccccacaagtgggcggtgggattggtcc |
10292216 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
| |||||||| | |||| |||||||| |||||||||||| |
|
|
| T |
10292217 |
cttcggattagttgattcttggatcgaataccgagtttt |
10292255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 190 - 279
Target Start/End: Original strand, 18128625 - 18128714
Alignment:
| Q |
190 |
tttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcccctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
|||||| || ||||||||||||||||||||||| ||||||| ||||||||| ||| ||||| ||| || |||||||| |||||||||||| |
|
|
| T |
18128625 |
tttgctctggctttaaacggggcccccgcaagtgggcggtgggattggtcctctcagattagtcggttcttggatcgaataccgagtttt |
18128714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 142 - 281
Target Start/End: Original strand, 28964097 - 28964235
Alignment:
| Q |
142 |
gttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtccc |
241 |
Q |
| |
|
|||||||||| ||| ||| |||||| ||||||||||||| |||| || | | || ||||||||||||||||||||||| |||| || |||||||||| |
|
|
| T |
28964097 |
gttcgattccatctggtgccaatttcggtgggctaagtccatacggagctatgtctggctttaaacggggcccccgcaagtgggcg-tgggattggtccc |
28964195 |
T |
 |
| Q |
242 |
ctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||| |||| |||||| || ||||| |||| ||||||||| |
|
|
| T |
28964196 |
ctcgaattagtcgattcttagatcgaatactgagttttca |
28964235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 141 - 238
Target Start/End: Original strand, 24999297 - 24999394
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggt |
238 |
Q |
| |
|
||||||||||||||| || |||||||| |||||||||| ||| ||| ||||| || ||||||||||||||||||||||| ||||||| ||||||| |
|
|
| T |
24999297 |
ggttcgattccctctgatgccaattttgatgggctaagttcatatagagcttgctctggctttaaacggggcccccgcaagtgggcggtgggattggt |
24999394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 142 - 279
Target Start/End: Complemental strand, 3403639 - 3403502
Alignment:
| Q |
142 |
gttcgattccctctagtgtcaattttggtgggctaagtcaatacagaa-tttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
|||||||||| ||| ||| |||||| ||||||| ||||| ||||| || |||| |||| ||||||| ||||||| || |||| ||||||||| ||||||| |
|
|
| T |
3403639 |
gttcgattccatctggtgccaatttcggtgggc-aagtccatacaaaactttgttttggctttaaatggggccctcgtaagtgggcggtgaggttggtcc |
3403541 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
||||| |||| || ||| || || | ||||||||||||| |
|
|
| T |
3403540 |
cctcgaattagtcaattcttagaccagataccgagtttt |
3403502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 141 - 281
Target Start/End: Complemental strand, 27746473 - 27746333
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttgg-cggtgagattggtc |
239 |
Q |
| |
|
||||||||||||| | ||| |||||| ||||||||||||| ||||||| ||||| || ||||||| |||||||| ||||| || || || ||| ||| |
|
|
| T |
27746473 |
ggttcgattccctttggtgccaatttcggtgggctaagtccatacagagcttgctctggctttaaaaggggcccca-caagtggggcgatggaattagtc |
27746375 |
T |
 |
| Q |
240 |
ccctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
||||||||||| |||||| |||||||| ||| ||| |||||| |
|
|
| T |
27746374 |
ccctcggattagtcgattcttggatcgaatatcgatttttca |
27746333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 141 - 271
Target Start/End: Complemental strand, 1372539 - 1372409
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaattt-gctttgactttaaacggggcccccgcaagttggcggtgagattggtc |
239 |
Q |
| |
|
||||||||||||||| ||||||||||| ||| | | ||| ||||||| ||| |||||||||| ||||||| |||||||||| ||||||| ||||| || |
|
|
| T |
1372539 |
ggttcgattccctctgatgtcaattttgatggac-aggtctatacagagttttgctttgacttaaaacgggccccccgcaagcaggcggtgggattgatc |
1372441 |
T |
 |
| Q |
240 |
ccctcggattaatcgattattggatcggatac |
271 |
Q |
| |
|
|||| |||||| ||| ||||||||||||| |
|
|
| T |
1372440 |
ccctttaattaattgatccttggatcggatac |
1372409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 141 - 279
Target Start/End: Original strand, 2166762 - 2166897
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
|||||||||||||| ||| |||||| || ||||||||| ||||||| ||||| || ||||||| | |||| |||||| ||||||| ||||||||| |
|
|
| T |
2166762 |
ggttcgattccctc--gtgccaatttcagtaggctaagtccatacagagcttgctctggctttaaataagacccc-gcaagtgggcggtgggattggtcc |
2166858 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
|||| ||||| |||||| || ||| |||||||||||||| |
|
|
| T |
2166859 |
cctcagattagtcgattttttgattggataccgagtttt |
2166897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 212 - 278
Target Start/End: Complemental strand, 7558018 - 7557952
Alignment:
| Q |
212 |
cccccgcaagttggcggtgagattggtcccctcggattaatcgattattggatcggataccgagttt |
278 |
Q |
| |
|
||||||||||| | ||||| |||||||||||||| |||| |||||| ||| |||||||||||||||| |
|
|
| T |
7558018 |
cccccgcaagtggacggtgggattggtcccctcgaattagtcgatttttgcatcggataccgagttt |
7557952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 141 - 281
Target Start/End: Original strand, 33746945 - 33747085
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtca-atacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtc |
239 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||||| || ||| ||| || |||| | || || ||||| |||||||||||| | ||||| |||||| |
|
|
| T |
33746945 |
ggttcgattccctctagtgttaatttcggtgggcaaattcatataaagc-tttgttctggtttagaacggagcccccgcaagtggacggtggaattggtt |
33747043 |
T |
 |
| Q |
240 |
ccctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
| ||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
33747044 |
ctctcggattagtcgatccttggatcggataccgagttttca |
33747085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 146 - 281
Target Start/End: Complemental strand, 9047411 - 9047277
Alignment:
| Q |
146 |
gattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcccctcg |
245 |
Q |
| |
|
||||||||||| || |||||||||||| ||||||| ||||| | || || ||||||||||||| |||||||| || | | ||| |||||| |||| | |
|
|
| T |
9047411 |
gattccctctaatgccaattttggtggactaagtccatacaaagcttactctgactttaaacggaacccccgcatgtggacagtggaattggt-cccttg |
9047313 |
T |
 |
| Q |
246 |
gattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||| ||| || |||||||||||||||| |||||| |
|
|
| T |
9047312 |
aattagtcggttcttggatcggataccgaattttca |
9047277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 233 - 279
Target Start/End: Original strand, 9713609 - 9713655
Alignment:
| Q |
233 |
attggtcccctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
|||||||| ||||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
9713609 |
attggtccactcggattagtcgattcttggatcggataccgagtttt |
9713655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 135 - 279
Target Start/End: Original strand, 28908880 - 28909025
Alignment:
| Q |
135 |
gtttcgggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaa-tttgctttgactttaaacggggcccccgcaagttggcggtgaga |
233 |
Q |
| |
|
||||| ||||| ||||||||| ||||||||| |||||| ||||| ||||||| |||| | || ||||||||||||| ||||||||| |||| || || |
|
|
| T |
28908880 |
gtttcaggttcaattccctctggtgtcaattacagtgggc-aagtccatacagagctttgttctggctttaaacggggctcccgcaagtgggcgatgtga |
28908978 |
T |
 |
| Q |
234 |
ttggtcccctcggattaatcgattattggatc-ggataccgagtttt |
279 |
Q |
| |
|
||| ||||||| ||||| ||| | ||||||| ||| |||||||||| |
|
|
| T |
28908979 |
ttgatcccctcagattagtcggtccttggatcgggacaccgagtttt |
28909025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 200 - 274
Target Start/End: Complemental strand, 43817828 - 43817754
Alignment:
| Q |
200 |
ctttaaacggggcccccgcaagttggcggtgagattggtcccctcggattaatcgattattggatcggataccga |
274 |
Q |
| |
|
|||||||| || ||||||||||| ||||||| ||||||| |||| ||||||||||| ||||||||||| |||| |
|
|
| T |
43817828 |
ctttaaacaggacccccgcaagtgggcggtggaattggtctcctcaaattaatcgattcttggatcggatgccga |
43817754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 136 - 241
Target Start/End: Original strand, 21667608 - 21667713
Alignment:
| Q |
136 |
tttcgggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagatt |
235 |
Q |
| |
|
|||| ||||||||| ||| | ||| ||||| ||||||||||||| ||||||| ||||| || |||||||||| || |||||||| ||||||| ||| |
|
|
| T |
21667608 |
tttcaggttcgatttcctttggtgctaatttcggtgggctaagtccatacagagcttgctctgcctttaaacggagcatccgcaagtgggcggtggaatt |
21667707 |
T |
 |
| Q |
236 |
ggtccc |
241 |
Q |
| |
|
|||||| |
|
|
| T |
21667708 |
ggtccc |
21667713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 231 - 281
Target Start/End: Complemental strand, 5740431 - 5740381
Alignment:
| Q |
231 |
agattggtcccctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||||||||||||||||| ||| | |||||||||| |||||||||||| |
|
|
| T |
5740431 |
agattggtcccctcggattagtcggtccttggatcggacaccgagttttca |
5740381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 151 - 281
Target Start/End: Complemental strand, 36848877 - 36848748
Alignment:
| Q |
151 |
cctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcccctcggatta |
250 |
Q |
| |
|
||||| ||| |||||| ||||||||||||| |||| || |||||| | ||||||| | ||| || ||||| ||||||| |||| |||||||| |||| |
|
|
| T |
36848877 |
cctctggtgccaatttcggtgggctaagtccatacggagtttgctcgggctttaaatgaggcacca-caagtgggcggtgggattagtcccctcaaatta |
36848779 |
T |
 |
| Q |
251 |
atcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
||| || |||||||||||||| | |||||| |
|
|
| T |
36848778 |
gtcggtttttggatcggataccaaattttca |
36848748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 141 - 177
Target Start/End: Original strand, 11819843 - 11819879
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaa |
177 |
Q |
| |
|
|||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
11819843 |
ggttcgattcactctagtgtcaatttgggtgggctaa |
11819879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 217 - 281
Target Start/End: Original strand, 16990722 - 16990786
Alignment:
| Q |
217 |
gcaagttggcggtgagattggtcccctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||| ||||||| || ||||||||| |||||| ||| | |||||||||||||| |||||||| |
|
|
| T |
16990722 |
gcaagtgggcggtgggactggtccccttggattagtcggtccttggatcggataccaagttttca |
16990786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 216 - 272
Target Start/End: Complemental strand, 26168912 - 26168856
Alignment:
| Q |
216 |
cgcaagttggcggtgagattggtcccctcggattaatcgattattggatcggatacc |
272 |
Q |
| |
|
||||||| || | ||||||||||||||||||| || |||||| |||||||| ||||| |
|
|
| T |
26168912 |
cgcaagtgggggatgagattggtcccctcggagtagtcgattcttggatcgaatacc |
26168856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 141 - 177
Target Start/End: Complemental strand, 33727882 - 33727846
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaa |
177 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||||| |
|
|
| T |
33727882 |
ggttcgattccctctagtgtcaatttggatgggctaa |
33727846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 141 - 177
Target Start/End: Complemental strand, 44780123 - 44780087
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaa |
177 |
Q |
| |
|
|||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
44780123 |
ggtttgattccctctagtgtcaatttgggtgggctaa |
44780087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 93; Significance: 3e-45; HSPs: 60)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 141 - 281
Target Start/End: Original strand, 22119951 - 22120091
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| ||| |||||| ||||||||||||| ||||||| ||||| || ||||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
22119951 |
ggttcgattccctctggtgccaatttcggtgggctaagtccatacagagcttgctctggctttaaacggggcccccgcaagtgggcggtgggattggtcc |
22120050 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
22120051 |
cctcggattagtcgattcttggatcggataccgagttttca |
22120091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 141 - 281
Target Start/End: Complemental strand, 40543048 - 40542908
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| ||| |||||| ||||||||||||| ||||||| ||||| || ||||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
40543048 |
ggttcgattccctctggtgccaatttcggtgggctaagtccatacagagcttgctctggctttaaacggggcccccgcaagtgggcggtgggattggtcc |
40542949 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
40542948 |
cctcggattagtcgattcttggatcggataccgagttttca |
40542908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 89; E-Value: 8e-43
Query Start/End: Original strand, 141 - 281
Target Start/End: Original strand, 2751334 - 2751474
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| ||| |||||| ||||||||||||| ||||||| ||||| || ||||||||||||||||||||| | ||||||| ||||||||| |
|
|
| T |
2751334 |
ggttcgattccctctggtgccaatttcggtgggctaagtccatacagagcttgctctggctttaaacggggcccccgcaaatgggcggtgggattggtcc |
2751433 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
2751434 |
cctcggattagtcgattcttggatcggataccgagttttca |
2751474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 89; E-Value: 8e-43
Query Start/End: Original strand, 141 - 281
Target Start/End: Original strand, 21835214 - 21835354
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| ||| |||||| ||||||||||||| ||||||| ||||| || ||||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
21835214 |
ggttcgattccctctggtgccaatttcggtgggctaagtccatacagagcttgctctggctttaaacggggcccccgcaagtgggcggtgggattggtcc |
21835313 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||||||| |||||| |||||||||||| |||||||||| |
|
|
| T |
21835314 |
cctcggattagtcgattcttggatcggatatcgagttttca |
21835354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 141 - 279
Target Start/End: Original strand, 7275340 - 7275478
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| ||| |||||| ||||||||||||| ||||||| ||||| || |||||||| |||||||||||||| ||||||| ||||||||| |
|
|
| T |
7275340 |
ggttcgattccctctggtgccaatttcggtgggctaagtccatacagagcttgctctggctttaaacagggcccccgcaagtgggcggtgggattggtcc |
7275439 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
7275440 |
cctcggattagtcgattcttggatcggataccgagtttt |
7275478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 141 - 281
Target Start/End: Original strand, 29861733 - 29861873
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| ||| |||||| ||||||||||||| |||||||| ||||| || ||||||||||||||||||||||| ||||||| ||||| ||| |
|
|
| T |
29861733 |
ggttcgattccctctggtgccaatttcggtgggctaagtccatacagaacttgctctggctttaaacggggcccccgcaagtgggcggtgggattgatcc |
29861832 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
||||| |||| |||||| || |||||||||||||||||||| |
|
|
| T |
29861833 |
cctcgaattagtcgattcttagatcggataccgagttttca |
29861873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 143 - 281
Target Start/End: Original strand, 16374059 - 16374197
Alignment:
| Q |
143 |
ttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcccc |
242 |
Q |
| |
|
||||||||||||| ||| |||||| |||||| |||||| |||||||||||||| || ||||||||||| ||||||||| | | ||||| ||||||||||| |
|
|
| T |
16374059 |
ttcgattccctctggtgccaatttcggtgggttaagtccatacagaatttgctatggctttaaacgggacccccgcaaatggacggtgggattggtcccc |
16374158 |
T |
 |
| Q |
243 |
tcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
16374159 |
tcggattagtcgattcttggatcggataccgagttttca |
16374197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 142 - 279
Target Start/End: Complemental strand, 17197087 - 17196950
Alignment:
| Q |
142 |
gttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtccc |
241 |
Q |
| |
|
|||||||||||||| ||| |||||| |||| |||||||| ||||||| ||||| || ||||||||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
17197087 |
gttcgattccctctggtgccaatttcggtgagctaagtccatacagagcttgctctggctttaaacggggcccccgcaagtgggcggtgggattggtccc |
17196988 |
T |
 |
| Q |
242 |
ctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
|||| |||| |||||| ||||||||||||||||||||| |
|
|
| T |
17196987 |
ctcgaattagtcgattcttggatcggataccgagtttt |
17196950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 141 - 281
Target Start/End: Complemental strand, 654842 - 654703
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| ||| |||||| ||||||||||||| ||||||| ||||| || ||||||||||| ||||||||||| ||||||| ||||||||| |
|
|
| T |
654842 |
ggttcgattccctctggtgccaatttcggtgggctaagtccatacagagcttgctctggctttaaacggg-cccccgcaagtgggcggtgggattggtcc |
654744 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||||||| ||| || ||||||||||||||||||||||| |
|
|
| T |
654743 |
cctcggattagtcggttcttggatcggataccgagttttca |
654703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 141 - 281
Target Start/End: Complemental strand, 7176000 - 7175860
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| ||| |||||| ||||||||||||| ||||||| ||||| || |||||||| || ||||||||||| ||||||| ||||||||| |
|
|
| T |
7176000 |
ggttcgattccctctggtgccaatttcggtgggctaagtccatacagagcttgctctggctttaaacaggacccccgcaagtgggcggtgggattggtcc |
7175901 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||||||| |||||| ||||||||||||| ||||||||| |
|
|
| T |
7175900 |
cctcggattagtcgattcttggatcggatactgagttttca |
7175860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 141 - 281
Target Start/End: Original strand, 22703549 - 22703689
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| |||||||||| ||||||||||||| ||||| | ||||| || ||||||||||| ||||||||||| ||||||| ||||||||| |
|
|
| T |
22703549 |
ggttcgattccctctggtgtcaatttcggtgggctaagtccatacaaagcttgctctggctttaaacgggacccccgcaagtgggcggtgggattggtcc |
22703648 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||||||| |||||| || ||||||||||| |||||||| |
|
|
| T |
22703649 |
cctcggattagtcgattctttgatcggatacccagttttca |
22703689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 141 - 281
Target Start/End: Original strand, 11997912 - 11998052
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| ||| |||||| ||| ||||||||| ||||| | ||||| || |||||||| |||||||||||||| ||||||| ||||||||| |
|
|
| T |
11997912 |
ggttcgattccctctggtgccaatttcggttggctaagtccatacatagcttgctctggctttaaactgggcccccgcaagtgggcggtgggattggtcc |
11998011 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
||||| |||| |||||| ||||||||||||||||||||||| |
|
|
| T |
11998012 |
cctcgaattagtcgattcttggatcggataccgagttttca |
11998052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 141 - 279
Target Start/End: Original strand, 18044170 - 18044308
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| ||| |||||| ||||||||||||| ||||||| ||||| || ||||||||||||||||| ||||| || |||| |||||||| |
|
|
| T |
18044170 |
ggttcgattccctcttgtgccaatttcggtgggctaagtccatacagagcttgctctggctttaaacggggcccccacaagtgggtggtggaattggtcc |
18044269 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
|||| ||||| |||||| ||||||||||||||||||||| |
|
|
| T |
18044270 |
cctcagattagtcgattcttggatcggataccgagtttt |
18044308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 135 - 281
Target Start/End: Original strand, 27312209 - 27312355
Alignment:
| Q |
135 |
gtttcgggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagat |
234 |
Q |
| |
|
||||| ||||||||||||||||||| |||||| | || || ||||| ||||||| | || ||||||||||||| |||||||||||| ||||||| ||| |
|
|
| T |
27312209 |
gtttcaggttcgattccctctagtgccaatttcgatgtgccaagtccatacagagctacctctgactttaaacggagcccccgcaagtgggcggtgggat |
27312308 |
T |
 |
| Q |
235 |
tggtcccctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||||||| ||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
27312309 |
tggtcccctcagattagtcgattcttggatcggataccgagttttca |
27312355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 149 - 281
Target Start/End: Original strand, 23092167 - 23092299
Alignment:
| Q |
149 |
tccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcccctcggat |
248 |
Q |
| |
|
||||||| ||| |||||| ||||||||||||| ||||||| ||||| || ||||||||||||||||||||| | | ||||| ||||||||||||||||| |
|
|
| T |
23092167 |
tccctctggtgccaatttcggtgggctaagtccatacagagcttgctctggctttaaacggggcccccgcaaatggacggtgggattggtcccctcggat |
23092266 |
T |
 |
| Q |
249 |
taatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|| |||||| |||||||||||||||||||||| |
|
|
| T |
23092267 |
tagtcgattcatggatcggataccgagttttca |
23092299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 143 - 281
Target Start/End: Original strand, 2344364 - 2344502
Alignment:
| Q |
143 |
ttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcccc |
242 |
Q |
| |
|
||||||||| ||| ||| |||||||||||||||||||| ||||||| || |||| ||||||||||| ||||||||||| |||||| ||||||||||| |
|
|
| T |
2344364 |
ttcgattccttctggtgccaattttggtgggctaagtccatacagagctttttttggctttaaacgggacccccgcaagtgagcggtgggattggtcccc |
2344463 |
T |
 |
| Q |
243 |
tcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||||| ||| | ||||||||||||||||||||||| |
|
|
| T |
2344464 |
tcggattagtcggtccttggatcggataccgagttttca |
2344502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 161 - 279
Target Start/End: Original strand, 3851840 - 3851958
Alignment:
| Q |
161 |
caattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcccctcggattaatcgattatt |
260 |
Q |
| |
|
|||||| ||||||||||||| ||| ||| ||||| || ||||||||||||||||||||||| ||||||| ||||| ||||||||||||| |||||| || |
|
|
| T |
3851840 |
caatttcggtgggctaagtccatatagagcttgctctggctttaaacggggcccccgcaagtgggcggtgggattgatcccctcggattagtcgattctt |
3851939 |
T |
 |
| Q |
261 |
ggatcggataccgagtttt |
279 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
3851940 |
ggatcggataccgagtttt |
3851958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 141 - 282
Target Start/End: Complemental strand, 21217971 - 21217830
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| || |||||| ||||||||||||| ||||||| ||||| | ||||||||||| ||||| ||||| ||||||| ||||| ||| |
|
|
| T |
21217971 |
ggttcgattccctctgatgccaatttcggtgggctaagtccatacagagcttgctctagctttaaacgggccccccacaagtgggcggtgggattgatcc |
21217872 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttcag |
282 |
Q |
| |
|
|||||||||| | |||| |||||||||||||||||||||||| |
|
|
| T |
21217871 |
cctcggattagttgattcttggatcggataccgagttttcag |
21217830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 141 - 281
Target Start/End: Complemental strand, 23012646 - 23012506
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
|||| |||||||||||||| |||||| ||||||||||||| ||||||| ||||| || ||||||| ||||||||| ||||| ||||||| ||||||||| |
|
|
| T |
23012646 |
ggtttgattccctctagtgccaatttcggtgggctaagtccatacagagcttgctctggctttaaatggggcccccacaagtgggcggtgggattggtcc |
23012547 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
||||| |||| || ||| | |||||||||||||||||||| |
|
|
| T |
23012546 |
cctcgtattagtcaattcattgatcggataccgagttttca |
23012506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 141 - 281
Target Start/End: Original strand, 28089879 - 28090022
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaat----ttgctttgactttaaacggggcccccgcaagttggcggtgagattg |
236 |
Q |
| |
|
|||||||| |||||| |||||||||| ||||||||||||| ||||| | | ||||| || ||||||| ||| ||||||||||| |||| |||||||| |
|
|
| T |
28089879 |
ggttcgataccctctggtgtcaatttcggtgggctaagtccatacaaagtgagcttgctctggctttaaatggg-cccccgcaagtgggcgatgagattg |
28089977 |
T |
 |
| Q |
237 |
gtcccctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
28089978 |
gtcccctcggattagtcgattcttggatcggataccgagttttca |
28090022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 141 - 281
Target Start/End: Original strand, 2103118 - 2103256
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| | | |||||| ||||||||||||| ||||||| ||||| || ||||||| ||||||||||||||| ||||||| ||||||| | |
|
|
| T |
2103118 |
ggttcgattccctctggagccaatttcggtgggctaagtccatacagagcttgctctggctttaaatggggcccccgcaagtgggcggtgggattggt-c |
2103216 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||||||| |||||| | |||||||||||||||||||| |
|
|
| T |
2103217 |
cctcggattagtcgattcat-gatcggataccgagttttca |
2103256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 141 - 281
Target Start/End: Original strand, 10091251 - 10091390
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| | | |||||| ||||||||||||| ||||||| ||||| || ||||||| |||| |||||||||| ||||||| ||||| ||| |
|
|
| T |
10091251 |
ggttcgattccctctggagccaatttcggtgggctaagtccatacagagcttgctctggctttaaatggggtccccgcaagtgggcggtgggattgatcc |
10091350 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||||||| |||||| || |||| ||||||||||||||| |
|
|
| T |
10091351 |
cctcggattagtcgattctt-gatccgataccgagttttca |
10091390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 141 - 279
Target Start/End: Original strand, 27009422 - 27009561
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgc-aagttggcggtgagattggtc |
239 |
Q |
| |
|
|||||||| |||||| ||| |||||| ||||||||||||| ||||||| ||||| ||||||||||||||||||| || |||| | ||||| |||||||| |
|
|
| T |
27009422 |
ggttcgatcccctctggtgccaatttcggtgggctaagtccatacagagcttgctctgactttaaacggggcccctgcaaagtggacggtgggattggtc |
27009521 |
T |
 |
| Q |
240 |
ccctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
||||| |||| |||||| |||||| |||||||||||||| |
|
|
| T |
27009522 |
ccctcaaattagtcgattcttggattggataccgagtttt |
27009561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 141 - 279
Target Start/End: Complemental strand, 41907651 - 41907514
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
|||||||||| |||| ||| |||||| |||||||||||| ||||||| ||||| || ||||||||| ||||||||||||| || |||| ||||||||| |
|
|
| T |
41907651 |
ggttcgattctctctggtgccaatttcagtgggctaagtccatacagaggttgctctggctttaaacgtggcccccgcaagtgggtggtgggattggtcc |
41907552 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
|| | ||||| |||||| ||||||||||||||||||||| |
|
|
| T |
41907551 |
cc-cagattagtcgattcttggatcggataccgagtttt |
41907514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 141 - 278
Target Start/End: Original strand, 19421294 - 19421431
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||| | ||| |||||||||| | ||||||||||| ||||||| ||||| |||||||||| ||||| ||| ||||| ||||||| |||||||| |
|
|
| T |
19421294 |
ggttcgatttcttctggtgtcaatttcgatgggctaagtccatacagagcttgctctgactttaaatggggcgcccacaagtgggcggtgggattggtct |
19421393 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttt |
278 |
Q |
| |
|
|||||||||| |||||| ||| ||| |||||||||||| |
|
|
| T |
19421394 |
cctcggattagtcgattcttgaatcagataccgagttt |
19421431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 142 - 279
Target Start/End: Complemental strand, 22643479 - 22643342
Alignment:
| Q |
142 |
gttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtccc |
241 |
Q |
| |
|
|||||||| ||||| ||||||||| ||| ||||||||| ||||||| ||||| ||||||||||||| |||| ||||||| | ||||| |||| ||||| |
|
|
| T |
22643479 |
gttcgatttcctctgatgtcaatttcggtaggctaagtccatacagagcttgctctgactttaaacggagccctcgcaagtggccggtgtgattagtccc |
22643380 |
T |
 |
| Q |
242 |
ctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
|||||||||||||||| || |||| |||||| |||||| |
|
|
| T |
22643379 |
ctcggattaatcgattctttgatcagataccaagtttt |
22643342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 157 - 281
Target Start/End: Original strand, 31197669 - 31197793
Alignment:
| Q |
157 |
gtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcccctcggattaatcgat |
256 |
Q |
| |
|
|||||||||| ||||| |||||| ||||||| ||||| | ||||||||||||||||||||||| | ||||| ||||||||||||| ||||| ||||| |
|
|
| T |
31197669 |
gtgtcaatttcggtggattaagtccatacagatcttgctcttgctttaaacggggcccccgcaagtggtcggtgggattggtcccctcagattagtcgat |
31197768 |
T |
 |
| Q |
257 |
tattggatcggataccgagttttca |
281 |
Q |
| |
|
| |||||||||||| |||||||||| |
|
|
| T |
31197769 |
tcttggatcggatatcgagttttca |
31197793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 138 - 278
Target Start/End: Original strand, 32849651 - 32849791
Alignment:
| Q |
138 |
tcgggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattgg |
237 |
Q |
| |
|
||||||| ||||||||||||| ||||||||||||||||||||| | || || ||||| || ||||||| ||| | ||| |||| ||| ||| |||||| |
|
|
| T |
32849651 |
tcgggtttgattccctctagtctcaattttggtgggctaagtccacactgagcttgctctggctttaaatgggactcccataagtgggcagtgggattgg |
32849750 |
T |
 |
| Q |
238 |
tcccctcggattaatcgattattggatcggataccgagttt |
278 |
Q |
| |
|
||||||| ||||| |||||| |||||||||||||||||||| |
|
|
| T |
32849751 |
tcccctcagattagtcgattcttggatcggataccgagttt |
32849791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 161 - 281
Target Start/End: Complemental strand, 42913631 - 42913511
Alignment:
| Q |
161 |
caattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcccctcggattaatcgattatt |
260 |
Q |
| |
|
|||||| | |||| |||||| |||| ||| ||||| || ||||||||||||||||||||||| | ||||| ||||||||||||||||||| | |||| || |
|
|
| T |
42913631 |
caatttcgatgggataagtccatacggaacttgctctggctttaaacggggcccccgcaagtggacggtgggattggtcccctcggattagttgattctt |
42913532 |
T |
 |
| Q |
261 |
ggatcggataccgagttttca |
281 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
42913531 |
agatcggataccgagttttca |
42913511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 147 - 278
Target Start/End: Original strand, 9683895 - 9684026
Alignment:
| Q |
147 |
attccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcccctcgg |
246 |
Q |
| |
|
||||||||||||| |||||| ||||||||||||| |||| || || || || |||||||||||| |||| ||||| |||||| ||| ||||||||||| |
|
|
| T |
9683895 |
attccctctagtgccaatttcggtgggctaagtccataccgagcttactctggctttaaacggggtccccacaagtgggcggtaggataggtcccctcgg |
9683994 |
T |
 |
| Q |
247 |
attaatcgattattggatcggataccgagttt |
278 |
Q |
| |
|
||||||||||| |||||||| |||||||||| |
|
|
| T |
9683995 |
attaatcgattcttggatcgattaccgagttt |
9684026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 142 - 281
Target Start/End: Original strand, 31273978 - 31274116
Alignment:
| Q |
142 |
gttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtccc |
241 |
Q |
| |
|
|||||||||||||| | | ||||| || |||||||||| ||||||| ||||| || ||||||||||||| || |||||| ||| |||||||||||||| |
|
|
| T |
31273978 |
gttcgattccctctggagctaatttcggcgggctaagtccatacagagcttgctctggctttaaacggggctcc-gcaagtgggcagtgagattggtccc |
31274076 |
T |
 |
| Q |
242 |
ctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||| |||| |||||| ||||| ||||||||||||||||| |
|
|
| T |
31274077 |
ctcgaattagtcgattcttggaccggataccgagttttca |
31274116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 142 - 281
Target Start/End: Complemental strand, 43785436 - 43785297
Alignment:
| Q |
142 |
gttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtccc |
241 |
Q |
| |
|
||||||||||| || ||| ||||| |||| ||||||| ||||||| || || || ||||||||||||| |||||||| | |||||||||||||||| |
|
|
| T |
43785436 |
gttcgattcccacttgtgctaatttcagtggactaagtccatacagagcttactctggttttaaacggggcctccgcaagtggacggtgagattggtccc |
43785337 |
T |
 |
| Q |
242 |
ctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|| |||||| |||||| ||||||||||||||||| ||||| |
|
|
| T |
43785336 |
cttggattagtcgatttttggatcggataccgagctttca |
43785297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 141 - 279
Target Start/End: Original strand, 28950934 - 28951072
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||| ||||||| ||| |||||| |||||||||||| ||| ||| ||||| || ||||||||||| ||| ||||||| ||||||| ||||||||| |
|
|
| T |
28950934 |
ggttcgactccctctggtgccaatttcggtgggctaagttcatatagagcttgctctggctttaaacgggtccctcgcaagtcggcggtgggattggtcc |
28951033 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
||||| | || | ||| ||||||||||||||||||||| |
|
|
| T |
28951034 |
cctcgaactagacaattcttggatcggataccgagtttt |
28951072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 141 - 281
Target Start/End: Original strand, 17212116 - 17212255
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||| |||| |||| ||| |||||| ||||||||||||| ||||||| ||||| || ||| ||||||| |||| |||||| | |||| ||||||||| |
|
|
| T |
17212116 |
ggttcaattctctctggtgccaatttcggtgggctaagtccatacagagattgctctggcttaaaacgggacccctgcaagtgagtggtgggattggtcc |
17212215 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||||||| |||||| ||||||| |||||| |||||||| |
|
|
| T |
17212216 |
cctcggattagtcgattcttggatcagatacc-agttttca |
17212255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 156 - 256
Target Start/End: Original strand, 21373788 - 21373888
Alignment:
| Q |
156 |
agtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcccctcggattaatcga |
255 |
Q |
| |
|
|||| |||||| ||||||||||||| ||||||| ||||| || ||||||||||||||||||||||| | ||||||||||||||| | ||||||| |||| |
|
|
| T |
21373788 |
agtgccaatttcggtgggctaagtctatacagagcttgctctggctttaaacggggcccccgcaagtggacggtgagattggtcctcacggattagtcga |
21373887 |
T |
 |
| Q |
256 |
t |
256 |
Q |
| |
|
| |
|
|
| T |
21373888 |
t |
21373888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 205 - 281
Target Start/End: Complemental strand, 21574176 - 21574100
Alignment:
| Q |
205 |
aacggggcccccgcaagttggcggtgagattggtcccctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||||||||||||||| ||| | ||||||||||||||||||||||| |
|
|
| T |
21574176 |
aacggggcccccacaagtaggcggtgagattggtcccctcggattagtcggtccttggatcggataccgagttttca |
21574100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 200 - 279
Target Start/End: Complemental strand, 31712981 - 31712902
Alignment:
| Q |
200 |
ctttaaacggggcccccgcaagttggcggtgagattggtcccctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
|||||| |||| ||| ||||||| ||||||| ||||||||||||||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
31712981 |
ctttaagcgggaccctcgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagtttt |
31712902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 141 - 279
Target Start/End: Complemental strand, 39145790 - 39145652
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaata-cagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtc |
239 |
Q |
| |
|
||||||||||||| | ||| |||||| ||||||||||||||||| |||| ||||| || ||||||||||| |||| |||||| | ||||| |||||||| |
|
|
| T |
39145790 |
ggttcgattccctgtggtgccaatttcggtgggctaagtcaataacagagcttgctctggctttaaacggg-cccctgcaagtggacggtgggattggtc |
39145692 |
T |
 |
| Q |
240 |
ccctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
|||||| |||| |||||| ||| ||| |||||| |||||| |
|
|
| T |
39145691 |
ccctcgaattagtcgattcttgaatcagataccaagtttt |
39145652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 161 - 279
Target Start/End: Complemental strand, 36772421 - 36772303
Alignment:
| Q |
161 |
caattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcccctcggattaatcgattatt |
260 |
Q |
| |
|
|||||| |||||||||||| ||||||| ||||| || |||||||||||||||||| ||| ||||||| ||| |||| ||||||||| |||||| || |
|
|
| T |
36772421 |
caatttcggtgggctaagttcatacagagcttgctctggctttaaacggggcccccgggagtgggcggtggaattagtcctctcggattagtcgattctt |
36772322 |
T |
 |
| Q |
261 |
ggatcggataccgagtttt |
279 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
36772321 |
tgatcggataccgagtttt |
36772303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 141 - 278
Target Start/End: Original strand, 22638355 - 22638488
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| ||| ||||| |||||| ||||| |||| ||||| || |||||||||||||| |||||||| ||||||| ||||| || |
|
|
| T |
22638355 |
ggttcgattccctctggtgctaatttcggtgggttaagtt----cagagcttgctctggctttaaacggggcctccgcaagtgggcggtgggattgatct |
22638450 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttt |
278 |
Q |
| |
|
||||| |||| |||||| |||||||||||||||||||| |
|
|
| T |
22638451 |
cctcgaattagtcgattcttggatcggataccgagttt |
22638488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 141 - 279
Target Start/End: Original strand, 28647032 - 28647170
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaattt-gctttgactttaaacggggcccccgcaagttggcggtgagattggtc |
239 |
Q |
| |
|
||||||||||||||| ||| |||||| ||||||| ||||||||||||| ||| ||| || ||| |||||||||||| ||||| ||||||| ||||||| |
|
|
| T |
28647032 |
ggttcgattccctctggtgccaatttcggtgggc-aagtcaatacagagttttgctctggcttataacggggcccccacaagtgggcggtgggattggtt |
28647130 |
T |
 |
| Q |
240 |
ccctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
|||||| |||| || | |||||||||||| |||||||| |
|
|
| T |
28647131 |
ccctcgaattagtctgtccttggatcggatatcgagtttt |
28647170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 152 - 279
Target Start/End: Complemental strand, 33137951 - 33137825
Alignment:
| Q |
152 |
ctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcccctcggattaa |
251 |
Q |
| |
|
|||| ||||||||||| |||||||||||| ||||||| | ||| | ||||||| ||||||| |||||| |||||||| ||||||||||||| |||| |
|
|
| T |
33137951 |
ctctggtgtcaattttagtgggctaagtccatacagagctcgctctagctttaaatggggccct-gcaagtgggcggtgaaattggtcccctcgaattag |
33137853 |
T |
 |
| Q |
252 |
tcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
|||||| || ||||||||| |||||||| |
|
|
| T |
33137852 |
tcgattcttagatcggatatcgagtttt |
33137825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 197 - 279
Target Start/End: Original strand, 25333522 - 25333603
Alignment:
| Q |
197 |
tgactttaaacggggcccccgcaagttggcggtgagattggtcccctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
||||||||||| || ||||||||||| ||| ||| ||||||||||||||||||| |||||| |||||||||| |||||||||| |
|
|
| T |
25333522 |
tgactttaaacaggccccccgcaagtgggcagtgggattggtcccctcggattagtcgattcttggatcgga-accgagtttt |
25333603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 141 - 279
Target Start/End: Original strand, 27704065 - 27704202
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||| ||| | ||| |||||| ||||||||||||| ||| ||| |||||||| ||||||| || ||||||||||| || |||| ||||| ||| |
|
|
| T |
27704065 |
ggttcgatttcctttggtgccaatttcggtgggctaagtccatagagagcttgctttggctttaaatgga-cccccgcaagtgggtggtgtgattgatcc |
27704163 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
|||| ||||| |||||| ||| ||| ||||||||||||| |
|
|
| T |
27704164 |
cctcagattagtcgattcttgaatcagataccgagtttt |
27704202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 141 - 281
Target Start/End: Complemental strand, 23330877 - 23330737
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaa-tttgctttgactttaaacggggcccccgcaagttggcggtgagattggtc |
239 |
Q |
| |
|
||||||| |||||| ||| |||||| ||||||| ||||| ||||||| |||||| || ||| ||||||| || |||||||| |||||| ||||||||| |
|
|
| T |
23330877 |
ggttcgactccctccggtgccaatttcggtgggc-aagtccatacagagctttgctctggcttaaaacgggacctccgcaagtgggcggtaagattggtc |
23330779 |
T |
 |
| Q |
240 |
ccctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
||||| |||| || || ||||||||||||||||||||||| |
|
|
| T |
23330778 |
ccctcaaattagtcaatccttggatcggataccgagttttca |
23330737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 142 - 281
Target Start/End: Complemental strand, 9718124 - 9717985
Alignment:
| Q |
142 |
gttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtccc |
241 |
Q |
| |
|
|||||||||||||| |||||||||| | ||||||||||| ||| ||| ||||| || ||||||||||||||| | ||| | |||||| ||||||| | |
|
|
| T |
9718124 |
gttcgattccctctggtgtcaatttcgatgggctaagtccatagagagcttgctctggctttaaacggggccctcacaaatgagcggtggaattggtctc |
9718025 |
T |
 |
| Q |
242 |
ctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||| |||| ||| || ||| |||| |||| ||||||||| |
|
|
| T |
9718024 |
ctcgaattagtcggttcttgaatcgaatactgagttttca |
9717985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 141 - 215
Target Start/End: Complemental strand, 14199804 - 14199730
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccc |
215 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||||||| ||| ||| ||||| || |||||||||||||||| |
|
|
| T |
14199804 |
ggttcgattccctctaatgccaattttggtgggctaagtctatatagagcttgctctgcctttaaacggggcccc |
14199730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 142 - 274
Target Start/End: Complemental strand, 1766280 - 1766149
Alignment:
| Q |
142 |
gttcgattccctctagtgtcaattttggtgggctaagtcaatacagaa-tttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
|||||||||||| | |||||||||| |||||| |||||| |||||||| ||||| ||| ||| ||||||||||| ||||| |||||| ||||||||| |
|
|
| T |
1766280 |
gttcgattcccttttgtgtcaatttcggtggg-taagtccatacagaactttgccttggcttagaacggggcccca-caagtgggcggttggattggtcc |
1766183 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccga |
274 |
Q |
| |
|
|||||||||| ||| | ||| |||||||||||| |
|
|
| T |
1766182 |
cctcggattagtcggtacttgaatcggataccga |
1766149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 141 - 206
Target Start/End: Original strand, 42814927 - 42814992
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaa |
206 |
Q |
| |
|
||||||||||||||| |||||||||| ||||||||||||| ||||| | ||||| |||||||||| |
|
|
| T |
42814927 |
ggttcgattccctctggtgtcaatttcggtgggctaagtccatacaaagcttgctctgactttaaa |
42814992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 212 - 271
Target Start/End: Complemental strand, 8943468 - 8943409
Alignment:
| Q |
212 |
cccccgcaagttggcggtgagattggtcccctcggattaatcgattattggatcggatac |
271 |
Q |
| |
|
||||||||||| ||||||| |||||||||||| | |||| |||||| ||||||||||||| |
|
|
| T |
8943468 |
cccccgcaagtgggcggtgtgattggtccccttgaattagtcgattcttggatcggatac |
8943409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 200 - 279
Target Start/End: Complemental strand, 25102887 - 25102809
Alignment:
| Q |
200 |
ctttaaacggggcccccgcaagttggcggtgagattggtcccctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
|||||||| ||||||||||||| || ||||| ||||||| || |||||||| |||||| ||||||| |||||||| |||| |
|
|
| T |
25102887 |
ctttaaacagggcccccgcaag-tgacggtgggattggttccttcggattagtcgattcttggatcagataccgattttt |
25102809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 141 - 177
Target Start/End: Complemental strand, 33181219 - 33181183
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaa |
177 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| |
|
|
| T |
33181219 |
ggttcgattccctctagtgtcaatttgggtgggctaa |
33181183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 141 - 177
Target Start/End: Complemental strand, 48983742 - 48983706
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaa |
177 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| |
|
|
| T |
48983742 |
ggttcgattccctctagtgtcaatttgggtgggctaa |
48983706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 234 - 281
Target Start/End: Original strand, 22299958 - 22300005
Alignment:
| Q |
234 |
ttggtcccctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
||||||| ||||||||| |||||| ||| ||||||||||||||||||| |
|
|
| T |
22299958 |
ttggtcctctcggattagtcgattcttgaatcggataccgagttttca |
22300005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 216 - 279
Target Start/End: Original strand, 22696459 - 22696522
Alignment:
| Q |
216 |
cgcaagttggcggtgagattggtcccctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
||||||| ||||| | ||||||||| ||||||||| ||| | ||||||||||||||||||||| |
|
|
| T |
22696459 |
cgcaagtaggcggcgggattggtcctctcggattagtcggtccttggatcggataccgagtttt |
22696522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 30345566 - 30345511
Alignment:
| Q |
222 |
ttggcggtgagattggtcccctcggattaatcgattattggatcggataccgagtt |
277 |
Q |
| |
|
||||||||| ||||||||||||||| ||| ||| || || |||||||||||||||| |
|
|
| T |
30345566 |
ttggcggtgggattggtcccctcgggttagtcggttcttagatcggataccgagtt |
30345511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 236 - 281
Target Start/End: Complemental strand, 13332477 - 13332432
Alignment:
| Q |
236 |
ggtcccctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
||||| ||||||||| |||||| ||||||| ||||||||||||||| |
|
|
| T |
13332477 |
ggtccactcggattagtcgattcttggatcagataccgagttttca |
13332432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 135 - 188
Target Start/End: Original strand, 36173092 - 36173144
Alignment:
| Q |
135 |
gtttcgggttcgattccctctagtgtcaattttggtgggctaagtcaatacaga |
188 |
Q |
| |
|
||||| ||||||||||||||| ||| |||||||||||||| ||||| ||||||| |
|
|
| T |
36173092 |
gtttcaggttcgattccctcttgtgccaattttggtgggc-aagtccatacaga |
36173144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 327 - 355
Target Start/End: Original strand, 25471962 - 25471990
Alignment:
| Q |
327 |
ctactaactctagttaacctatcaactaa |
355 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
25471962 |
ctactaactctagttaacctatcaactaa |
25471990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 200 - 248
Target Start/End: Original strand, 40332195 - 40332243
Alignment:
| Q |
200 |
ctttaaacggggcccccgcaagttggcggtgagattggtcccctcggat |
248 |
Q |
| |
|
||||| |||||||| || ||||| ||||||| ||||||||||||||||| |
|
|
| T |
40332195 |
ctttagacggggcctccacaagtgggcggtgggattggtcccctcggat |
40332243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 93; Significance: 3e-45; HSPs: 73)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 141 - 281
Target Start/End: Complemental strand, 27528933 - 27528793
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| ||| |||||| ||||||||||||| ||||||| ||||| || ||||| ||||||||||||||||| ||||||||||||||||| |
|
|
| T |
27528933 |
ggttcgattccctctggtgccaatttcggtgggctaagtccatacagagcttgctctggctttatacggggcccccgcaagtgggcggtgagattggtcc |
27528834 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
27528833 |
cctcggattagtcgattcttggatcggataccgagttttca |
27528793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 89; E-Value: 8e-43
Query Start/End: Original strand, 141 - 281
Target Start/End: Complemental strand, 34844896 - 34844756
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
|||||||||| |||| ||| |||||| ||||||||||||| ||||||| ||||| || ||||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
34844896 |
ggttcgattctctctggtgccaatttcggtgggctaagtccatacagagcttgctctggctttaaacggggcccccgcaagtgggcggtgggattggtcc |
34844797 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
34844796 |
cctcggattagtcgattcttggatcggataccgagttttca |
34844756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 89; E-Value: 8e-43
Query Start/End: Original strand, 141 - 281
Target Start/End: Complemental strand, 40058990 - 40058850
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
|||||||||| |||| ||| |||||| ||||||||||||| ||||||| ||||| || ||||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
40058990 |
ggttcgattctctctggtgccaatttcggtgggctaagtccatacagagcttgctctggctttaaacggggcccccgcaagtgggcggtgggattggtcc |
40058891 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
40058890 |
cctcggattagtcgattcttggatcggataccgagttttca |
40058850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 141 - 278
Target Start/End: Original strand, 52983678 - 52983815
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| ||| |||||| |||||||||||| ||||||| ||||| || ||||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
52983678 |
ggttcgattccctctggtgccaatttcagtgggctaagtccatacagagcttgctctggctttaaacggggcccccgcaagtgggcggtgggattggtcc |
52983777 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttt |
278 |
Q |
| |
|
|||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
52983778 |
cctcggattagtcgattcttggatcggataccgagttt |
52983815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 141 - 281
Target Start/End: Original strand, 32986256 - 32986396
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||| ||||||||| ||| |||||| ||||||||||||| ||||||| ||||| |||||||||| ||||||||||||||| ||||||| ||||||||| |
|
|
| T |
32986256 |
ggttcaattccctctggtgccaatttcggtgggctaagtccatacagagcttgctctgactttaaatggggcccccgcaagtgggcggtgggattggtcc |
32986355 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
||||||| || |||||| ||||||||||||||||||||||| |
|
|
| T |
32986356 |
cctcggaatagtcgattcttggatcggataccgagttttca |
32986396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 84; E-Value: 8e-40
Query Start/End: Original strand, 142 - 281
Target Start/End: Original strand, 44343574 - 44343713
Alignment:
| Q |
142 |
gttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtccc |
241 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||||||||| ||||||| ||||| |||||||||||||||| ||||||||| ||||||| |||||||||| |
|
|
| T |
44343574 |
gttcgattccctctggtgctaattttggtgggctaagtccatacagagcttgctctgactttaaacggggctcccgcaagtgggcggtgggattggtccc |
44343673 |
T |
 |
| Q |
242 |
ctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||| |||| |||||| ||| ||||||||||||||||||| |
|
|
| T |
44343674 |
ctcgaattagtcgattcttgaatcggataccgagttttca |
44343713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 141 - 280
Target Start/End: Complemental strand, 21387623 - 21387486
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||| ||||||| ||||| || ||||||||||| |||||||||| ||||||| | |||||| |
|
|
| T |
21387623 |
ggttcgattccctatagtgtcaattttggtgggctaagtctatacagagcttgctctggctttaaacgggatccccgcaagtgggcggtggg--tggtcc |
21387526 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttc |
280 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
21387525 |
cctcggattagtcgattattggatcggataccaagttttc |
21387486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 141 - 281
Target Start/End: Original strand, 32990494 - 32990634
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||| ||||| |||||| ||||||||||||| ||||||| ||||| || ||||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
32990494 |
ggttcgattccctttagtgccaatttcggtgggctaagtccatacagagcttgctctggctttaaacggggcccccgcaagtgggcggtgggattggtcc |
32990593 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
||||||| || |||||| |||||||| |||| ||||||||| |
|
|
| T |
32990594 |
cctcggactagtcgattcttggatcgaatactgagttttca |
32990634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 141 - 279
Target Start/End: Original strand, 34723858 - 34723996
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| ||| |||||| ||||||||||||| ||||| | ||||| || ||||||||||||||||||||||| || |||| ||||||||| |
|
|
| T |
34723858 |
ggttcgattccctctggtgccaatttcggtgggctaagtccatacaaagcttgctctggctttaaacggggcccccgcaagtgggtggtgggattggtcc |
34723957 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
34723958 |
tctcggattagtcgattcttggatcggataccgagtttt |
34723996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 141 - 281
Target Start/End: Complemental strand, 5609340 - 5609200
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
|||||||||| |||| ||| |||||| ||||||||||||| ||||||| ||||| || ||||||| ||||||||||||||| | ||||| ||||| ||| |
|
|
| T |
5609340 |
ggttcgattctctctggtgccaatttcggtgggctaagtccatacagagcttgctctggctttaaatggggcccccgcaagtggacggtgggattgatcc |
5609241 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
5609240 |
cctcggattagtcgattcttggatcggataccgagttttca |
5609200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 141 - 281
Target Start/End: Complemental strand, 36131648 - 36131508
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||| | ||| |||||| ||||| ||||||| ||||||| ||||| |||||||||||||| |||||| |||| ||||||| ||||||||| |
|
|
| T |
36131648 |
ggttcgattccctatggtgccaatttcggtggcctaagtccatacagagcttgctatgactttaaacgggacccccgtaagtgggcggtgggattggtcc |
36131549 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||||||| ||||||||| |||| ||||||||||||||| |
|
|
| T |
36131548 |
cctcggattagtcgattattagatcagataccgagttttca |
36131508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 141 - 281
Target Start/End: Complemental strand, 54127480 - 54127340
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||| ||||||||| ||| |||||| ||||||||||||| ||||||| ||||| || ||||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
54127480 |
ggttcaattccctcttgtgccaatttcggtgggctaagtctatacagagcttgctctggctttaaacggggcccccgcaagtgggcggtgggattggtcc |
54127381 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||||||| ||| || ||||| ||||||| ||||||||| |
|
|
| T |
54127380 |
cctcggattagtcggttcttggaccggatactgagttttca |
54127340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 141 - 279
Target Start/End: Complemental strand, 33696417 - 33696279
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||| ||||||||| ||| |||||| ||||||||||||| ||||||| ||||| || ||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
33696417 |
ggttcaattccctctggtgccaatttcggtgggctaagtccatacagagcttgctctggctttaaatggggcccccgcaagtgggcggtgagattggtcc |
33696318 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
||||||||| || ||| |||||||||||| |||||||| |
|
|
| T |
33696317 |
tctcggattagtcaattcttggatcggatatcgagtttt |
33696279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 141 - 270
Target Start/End: Complemental strand, 9517779 - 9517650
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
|||||||||| |||| ||| |||||| |||||||||||| ||||||| ||||| ||||||||||||||||||||||| || || |||||||||||||| |
|
|
| T |
9517779 |
ggttcgattctctctggtgccaatttcagtgggctaagtccatacagagcttgctctgactttaaacggggcccccgcaggtgggtggtgagattggtcc |
9517680 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggata |
270 |
Q |
| |
|
|||||||||| |||||| |||||||||||| |
|
|
| T |
9517679 |
cctcggattagtcgattcttggatcggata |
9517650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 141 - 281
Target Start/End: Complemental strand, 45787842 - 45787702
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| || |||||| |||||||||||| ||||||| ||||| || |||||||| |||||||||||||| | ||||| ||||||||| |
|
|
| T |
45787842 |
ggttcgattccctctgatgccaatttcagtgggctaagtccatacagagcttgctctggctttaaacagggcccccgcaagtggacggtgggattggtcc |
45787743 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
||||| |||| |||||| ||||||||||||||||||||||| |
|
|
| T |
45787742 |
cctcgaattagtcgattcttggatcggataccgagttttca |
45787702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 141 - 279
Target Start/End: Original strand, 20566409 - 20566547
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| ||| |||||| ||||||| ||||| ||||||| ||||| || |||||||||| |||||||||||| |||| || ||||||||| |
|
|
| T |
20566409 |
ggttcgattccctctggtgccaatttcggtgggcaaagtccatacagagcttgctctggctttaaacggagcccccgcaagtgggcgctgggattggtcc |
20566508 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
|||| ||||| |||||| |||||||||||| |||||||| |
|
|
| T |
20566509 |
cctcagattagtcgattcttggatcggatatcgagtttt |
20566547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 141 - 279
Target Start/End: Original strand, 49287917 - 49288054
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
|||||||||| |||| ||| |||||| ||||||||||||| ||||| |||||||| || ||||||||||| | ||||||||| |||| |||||||||||| |
|
|
| T |
49287917 |
ggttcgattctctctggtgccaatttcggtgggctaagtccatacaaaatttgctatggctttaaacggg-ctcccgcaagtgggcgctgagattggtcc |
49288015 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
|||||||||| |||||| ||||||| ||||| ||||||| |
|
|
| T |
49288016 |
cctcggattagtcgattcttggatcagatactgagtttt |
49288054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 141 - 277
Target Start/End: Complemental strand, 20078122 - 20077986
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
|||| ||||||| || ||| |||||| ||||||||||||| ||||||| ||||| || |||||||||||||||||| |||| ||||||| |||| || | |
|
|
| T |
20078122 |
ggtttgattcccactggtgccaatttcggtgggctaagtccatacagagcttgctctggctttaaacggggcccccgtaagtgggcggtgggattagttc |
20078023 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagtt |
277 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
20078022 |
cctcggattagtcgattcttggatcggataccgagtt |
20077986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 162 - 281
Target Start/End: Complemental strand, 19660649 - 19660530
Alignment:
| Q |
162 |
aattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcccctcggattaatcgattattg |
261 |
Q |
| |
|
||||| |||||| |||||| ||||||| ||||| || |||||||| |||||||||||||| ||||||| ||||| ||||||||||||| |||||| ||| |
|
|
| T |
19660649 |
aatttcggtgggataagtccatacagagcttgctctggctttaaacagggcccccgcaagtgggcggtgggattgatcccctcggattagtcgattcttg |
19660550 |
T |
 |
| Q |
262 |
gatcggataccgagttttca |
281 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
19660549 |
gatcggataccgagttttca |
19660530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 148 - 281
Target Start/End: Original strand, 46714459 - 46714592
Alignment:
| Q |
148 |
ttccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcccctcgga |
247 |
Q |
| |
|
|||||| | ||| |||||| ||||||||||||| ||||||| |||| | ||||||||||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
46714459 |
ttccctttggtgccaatttcggtgggctaagtccatacagagcttgcccttgctttaaacggggcccccgcaagtgggcggtgggattggtcccctcgga |
46714558 |
T |
 |
| Q |
248 |
ttaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
||| || ||| ||| ||||||||||||||||||| |
|
|
| T |
46714559 |
ttagtcaattcttgaatcggataccgagttttca |
46714592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 141 - 281
Target Start/End: Complemental strand, 18875654 - 18875515
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||||| ||||||| ||||| || |||||||| |||||||| ||||| || ||| ||||| ||| |
|
|
| T |
18875654 |
ggttcgattccctctgatgtcaatttcggtgggctaagtccatacagagcttgctctggctttaaac-gggcccccacaagtgggtagtgggattgatcc |
18875556 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||||||| || ||| ||||||| ||||||||||||||| |
|
|
| T |
18875555 |
cctcggattagtcaatttttggatcagataccgagttttca |
18875515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 161 - 281
Target Start/End: Original strand, 27574397 - 27574517
Alignment:
| Q |
161 |
caattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcccctcggattaatcgattatt |
260 |
Q |
| |
|
|||||| ||| |||||| | ||||||| ||||| || ||||||| ||||||||||||||| ||||||||| |||||||||||||||||||| ||| || |
|
|
| T |
27574397 |
caatttcggtaggctaaattcatacagagcttgctctggctttaaaaggggcccccgcaagtgggcggtgagtttggtcccctcggattaatcaattctt |
27574496 |
T |
 |
| Q |
261 |
ggatcggataccgagttttca |
281 |
Q |
| |
|
||||||||||| ||||||||| |
|
|
| T |
27574497 |
ggatcggatactgagttttca |
27574517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 147 - 278
Target Start/End: Original strand, 13550273 - 13550404
Alignment:
| Q |
147 |
attccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcccctcgg |
246 |
Q |
| |
|
||||||||||||| |||||| ||||||||||||| |||| || || || || |||||||||||| |||| ||||| |||||| ||| ||||||||||| |
|
|
| T |
13550273 |
attccctctagtgccaatttcggtgggctaagtccataccgagcttactctggctttaaacggggtccccacaagtgggcggtaggataggtcccctcgg |
13550372 |
T |
 |
| Q |
247 |
attaatcgattattggatcggataccgagttt |
278 |
Q |
| |
|
||||||||||| |||||||| |||||||||| |
|
|
| T |
13550373 |
attaatcgattcttggatcgattaccgagttt |
13550404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 141 - 279
Target Start/End: Original strand, 25852273 - 25852412
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaa-cggggcccccgcaagttggcggtgagattggtc |
239 |
Q |
| |
|
||||||||||||||| ||| |||||| ||||||||||||| ||||||| ||||| || ||||||| |||| ||| ||||||| ||| || |||||||| |
|
|
| T |
25852273 |
ggttcgattccctctggtgccaatttcggtgggctaagtccatacagagcttgctctggctttaaaacgggaccctcgcaagtgggcaatgggattggtc |
25852372 |
T |
 |
| Q |
240 |
ccctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
||||||||||| ||| || ||||| ||||||||||||||| |
|
|
| T |
25852373 |
ccctcggattagtcggttcttggaccggataccgagtttt |
25852412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 151 - 281
Target Start/End: Complemental strand, 55961881 - 55961752
Alignment:
| Q |
151 |
cctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcccctcggatta |
250 |
Q |
| |
|
||||| ||| |||||| ||||||||||||| ||||||| ||||| ||||||||||||||| |||| ||||| ||||||| ||||||| || |||||||| |
|
|
| T |
55961881 |
cctctggtgccaatttcggtgggctaagtccatacagagcttgctctgactttaaacgggg-ccccacaagtgggcggtgggattggttccttcggatta |
55961783 |
T |
 |
| Q |
251 |
atcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
||||||| ||| |||| ||||||| |||||| |
|
|
| T |
55961782 |
atcgattcttgaatcgaataccgaattttca |
55961752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 141 - 279
Target Start/End: Original strand, 35229227 - 35229365
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccg-caagttggcggtgagattggtc |
239 |
Q |
| |
|
||||||||||| |||| || |||||| ||||||||||||| ||||| | ||||| |||||||||||||| ||||| ||||| |||||| |||||||| |
|
|
| T |
35229227 |
ggttcgattccttcta-tgccaatttcggtgggctaagtccatacatagcttgctctgactttaaacgggtccccccacaagtgagcggtgggattggtc |
35229325 |
T |
 |
| Q |
240 |
ccctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
|||||| |||| |||||| |||||||||||||||| |||| |
|
|
| T |
35229326 |
ccctcgaattagtcgattcttggatcggataccgaatttt |
35229365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 134 - 281
Target Start/End: Original strand, 4911974 - 4912125
Alignment:
| Q |
134 |
agtttcgggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctt----tgactttaaacggggcccccgcaagttggcggt |
229 |
Q |
| |
|
|||||| ||||||||||||||| |||| ||||||||||| ||| ||| ||| ||| |||||| || |||||||||| |||||||||||| || ||| |
|
|
| T |
4911974 |
agtttcaggttcgattccctctggtgttaattttggtggcctatgtccatatagagcttgcttgctctggctttaaacggagcccccgcaagtgggtggt |
4912073 |
T |
 |
| Q |
230 |
gagattggtcccctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
| ||||| ||||| || |||| |||||| ||||||| ||||||||||||||| |
|
|
| T |
4912074 |
gtgattgatccccccgaattagtcgattcttggatcagataccgagttttca |
4912125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 141 - 279
Target Start/End: Original strand, 51535672 - 51535818
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaa----gtcaatacagaatttgc---tttgactttaaacggggccccc-gcaagttggcggtgag |
232 |
Q |
| |
|
||||||||||||||| ||| ||||||||||||||||| ||| ||||||| |||| | || ||||||||||||||||| |||||| ||||||| | |
|
|
| T |
51535672 |
ggttcgattccctctggtgccaattttggtgggctaattaagtccatacagagcttgcagctctggctttaaacggggcccccagcaagtgggcggtggg |
51535771 |
T |
 |
| Q |
233 |
attggtcccctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
||||||||||||| |||| |||||| || ||||||||||||| |||| |
|
|
| T |
51535772 |
attggtcccctcgaattagtcgattcttagatcggataccgaatttt |
51535818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 161 - 279
Target Start/End: Original strand, 51595101 - 51595219
Alignment:
| Q |
161 |
caattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcccctcggattaatcgattatt |
260 |
Q |
| |
|
|||||| | ||| |||| |||||| |||| ||||| |||||||||||||| |||||||||| | ||||| |||| || | ||||||||||||||| || |
|
|
| T |
51595101 |
caatttcgatggactaaatcaatagagaacttgctctgactttaaacgggatccccgcaagtggacggtggaattgatctcttcggattaatcgattctt |
51595200 |
T |
 |
| Q |
261 |
ggatcggataccgagtttt |
279 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
51595201 |
ggatcggataccgagtttt |
51595219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 141 - 274
Target Start/End: Original strand, 32942429 - 32942562
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
|||||||||| |||| || |||||| ||||||||||||| ||||||| || || || |||||||||| ||||| ||||| | ||||| ||||||||| |
|
|
| T |
32942429 |
ggttcgattctctctgatgccaatttcggtgggctaagtccatacagagcttactctggctttaaacggcccccccacaagtggacggtgggattggtcc |
32942528 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccga |
274 |
Q |
| |
|
|||||||| |||||||| |||||| ||| ||||| |
|
|
| T |
32942529 |
cctcggataaatcgattcttggattggaaaccga |
32942562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 141 - 229
Target Start/End: Complemental strand, 35674879 - 35674791
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggt |
229 |
Q |
| |
|
||||||||||||||| | | |||||| ||||||||||||| ||||||| ||||| || ||||||||||||||||||||||| |||||| |
|
|
| T |
35674879 |
ggttcgattccctctggagccaatttcggtgggctaagtccatacagagcttgctctgcctttaaacggggcccccgcaagtgggcggt |
35674791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 142 - 279
Target Start/End: Original strand, 34835589 - 34835726
Alignment:
| Q |
142 |
gttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggccccc-gcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||||||| |||| || | | || ||||||| |||||||| |||||| |||| |||||||||||| |
|
|
| T |
34835589 |
gttcgattccctctggtgtcaatttcggtgggctaagtccatacggagctatgtctggctttaaatagggccccccgcaagtgggcg-tgagattggtcc |
34835687 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
|||||||||| |||||| || ||||| |||| ||||||| |
|
|
| T |
34835688 |
cctcggattagtcgattcttagatcgaatactgagtttt |
34835726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 146 - 279
Target Start/End: Original strand, 12824464 - 12824597
Alignment:
| Q |
146 |
gattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcccctcg |
245 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||| ||| ||| |||||| | ||||||| || || || |||||| | ||||| |||||||| | ||| |
|
|
| T |
12824464 |
gattccctcttgtgtcaattttgatgggctaagttcatatagagtttgctctagctttaaatggagctcctgcaagtggacggtgggattggtctcatcg |
12824563 |
T |
 |
| Q |
246 |
gattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
|||| |||||| ||||||||||||| ||||||| |
|
|
| T |
12824564 |
aattagtcgattcttggatcggatacggagtttt |
12824597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 203 - 279
Target Start/End: Original strand, 4064981 - 4065057
Alignment:
| Q |
203 |
taaacggggcccccgcaagttggcggtgagattggtcccctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
||||||| |||||| ||||| ||||||| ||||||||||||||||||| |||||| |||||||||||| ||| |||| |
|
|
| T |
4064981 |
taaacggagcccccacaagtgggcggtgggattggtcccctcggattagtcgatttttggatcggatatcgaatttt |
4065057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 141 - 229
Target Start/End: Original strand, 33992685 - 33992773
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggt |
229 |
Q |
| |
|
|||||||||| |||| ||| |||||| ||||||||||||| ||||| | ||||| || ||||||||||||||||||||||| |||||| |
|
|
| T |
33992685 |
ggttcgattctctctggtgccaatttcggtgggctaagtccatacatagcttgctctggctttaaacggggcccccgcaagtgggcggt |
33992773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 142 - 281
Target Start/End: Complemental strand, 13584391 - 13584252
Alignment:
| Q |
142 |
gttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtccc |
241 |
Q |
| |
|
|||||||||||||| |||||||||| | ||||||||||| ||| ||| ||||| || ||||||||||||||| | ||| | |||||| ||||||| | |
|
|
| T |
13584391 |
gttcgattccctctggtgtcaatttcgatgggctaagtccatagagagcttgctctggctttaaacggggccctcacaaatgagcggtggaattggtctc |
13584292 |
T |
 |
| Q |
242 |
ctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||| |||| ||| || ||| |||| |||| ||||||||| |
|
|
| T |
13584291 |
ctcgaattagtcggttcttgaatcgaatactgagttttca |
13584252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 216 - 279
Target Start/End: Original strand, 23639758 - 23639821
Alignment:
| Q |
216 |
cgcaagttggcggtgagattggtcccctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
||||||| | ||||| ||||||||||||||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
23639758 |
cgcaagtggacggtgggattggtcccctcggattagtcgattcttggatcggataccgagtttt |
23639821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 216 - 279
Target Start/End: Original strand, 23645416 - 23645479
Alignment:
| Q |
216 |
cgcaagttggcggtgagattggtcccctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
||||||| | ||||| ||||||||||||||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
23645416 |
cgcaagtggacggtgggattggtcccctcggattagtcgattcttggatcggataccgagtttt |
23645479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 141 - 279
Target Start/End: Complemental strand, 12500196 - 12500059
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
|||| |||||||||| ||| |||||| ||||||||||| ||||| | ||||| || ||||||||||| ||||||||||| |||||| | |||| | | |
|
|
| T |
12500196 |
ggtttgattccctctggtgccaatttcaatgggctaagtccatacatagcttgctctggctttaaacgggacccccgcaagtgggcggtaaaattgat-c |
12500098 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
||||||||| || ||| ||||| ||||||||||||||| |
|
|
| T |
12500097 |
tctcggattagtcaattcttggaccggataccgagtttt |
12500059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 217 - 279
Target Start/End: Original strand, 52494623 - 52494685
Alignment:
| Q |
217 |
gcaagttggcggtgagattggtcccctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
|||||| ||||||| |||||||||||||| |||| |||||| ||||||||||||||||||||| |
|
|
| T |
52494623 |
gcaagtgggcggtgggattggtcccctcgaattagtcgattcttggatcggataccgagtttt |
52494685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 141 - 281
Target Start/End: Complemental strand, 7392101 - 7391963
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||| | ||| |||||| ||||| |||||| ||||||| |||||| || ||||||| ||| ||||| | || ||||||| ||||| ||| |
|
|
| T |
7392101 |
ggttcgattccctatggtgccaatttcggtggt-taagtccatacagagtttgctctggctttaaatgggacccccata-gtgggcggtgggattgttcc |
7392004 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||||||| ||| || || ||| |||||||||||||||| |
|
|
| T |
7392003 |
cctcggattagtcggttcttcgattggataccgagttttca |
7391963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 203 - 279
Target Start/End: Complemental strand, 9978585 - 9978509
Alignment:
| Q |
203 |
taaacggggcccccgcaagttggcggtgagattggtcccctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
|||| ||| ||||||||||| ||||||| |||||||||| |||||||| | |||| || |||||||||||||||||| |
|
|
| T |
9978585 |
taaatgggtcccccgcaagtgggcggtgggattggtcccatcggattagttgattcttagatcggataccgagtttt |
9978509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 161 - 281
Target Start/End: Complemental strand, 22488146 - 22488026
Alignment:
| Q |
161 |
caattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcccctcggattaatcgattatt |
260 |
Q |
| |
|
|||||| ||||| ||||||| ||| ||| ||| | || ||||||||||||||||||||| | ||||||| ||||| ||||||| |||| ||| | || |
|
|
| T |
22488146 |
caatttcggtggactaagtccatatagagcttgttctggctttaaacggggcccccgcaaatgggcggtgggattgatcccctcaaattagtcggtcctt |
22488047 |
T |
 |
| Q |
261 |
ggatcggataccgagttttca |
281 |
Q |
| |
|
|||||||||||| |||||||| |
|
|
| T |
22488046 |
ggatcggataccaagttttca |
22488026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 141 - 281
Target Start/End: Complemental strand, 30879303 - 30879164
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
|||| |||||||||| ||| |||||| | |||| ||| || ||||| | |||||| || ||||||| |||| || |||||| | ||||| ||||||| | |
|
|
| T |
30879303 |
ggtttgattccctctggtgccaatttcgatgggttaaatccatacaaagtttgctctggctttaaagggggtcct-gcaagtggacggtgggattggttc |
30879205 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||| |||||||||||| ||||||| |||||||| |||||| |
|
|
| T |
30879204 |
cctcagattaatcgattcttggatcagataccgaattttca |
30879164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 143 - 279
Target Start/End: Complemental strand, 13771619 - 13771482
Alignment:
| Q |
143 |
ttcgattccctctagtgtcaattttggtgggctaagtcaatacagaa--tttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||| ||||||| | ||||||||||||| |||| ||| | |||| || ||||||||||||| ||||||||| | | |||||||||||| |
|
|
| T |
13771619 |
ttcgattccctctgatgtcaatctcggtgggctaagtccatac-gaagctatgctctggctttaaacggggctcccgcaagtggatgatgagattggtcc |
13771521 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
||| |||| ||| || |||||||||||||||| |||| |
|
|
| T |
13771520 |
cctataattagtcggttcttggatcggataccgaatttt |
13771482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 141 - 243
Target Start/End: Original strand, 38740909 - 38741011
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaattt-gctttgactttaaacggggcccccgcaagttggcggtgagattggtc |
239 |
Q |
| |
|
||||||||||||||| |||||||||| ||||| | | ||| ||||||||||| |||||||||| |||||| | |||||||| ||||||| |||||||| |
|
|
| T |
38740909 |
ggttcgattccctctggtgtcaatttcggtggac-aggtctatacagaattttgctttgacttaaaacggacctcccgcaagcaggcggtgggattggtc |
38741007 |
T |
 |
| Q |
240 |
ccct |
243 |
Q |
| |
|
|||| |
|
|
| T |
38741008 |
ccct |
38741011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 211 - 281
Target Start/End: Complemental strand, 43719155 - 43719085
Alignment:
| Q |
211 |
gcccccgcaagttggcggtgagattggtcccctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
||||||| |||| ||||||| |||||||| ||||||||| |||||| |||||||||||||||| |||||| |
|
|
| T |
43719155 |
gcccccgaaagtgggcggtgggattggtcatctcggattagtcgattcttggatcggataccgaattttca |
43719085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 213 - 279
Target Start/End: Complemental strand, 55158409 - 55158343
Alignment:
| Q |
213 |
ccccgcaagttggcggtgagattggtcccctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
|||||||| | || |||| ||||||||||||||||||| |||||| |||||||||| |||||||||| |
|
|
| T |
55158409 |
ccccgcaaatgggtggtgggattggtcccctcggattagtcgatttttggatcggaaaccgagtttt |
55158343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 141 - 258
Target Start/End: Complemental strand, 13873433 - 13873316
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| ||| |||||| ||| |||||||| ||||||| |||||| | ||| |||| |||||||||||||| || |||| |||| ||| |
|
|
| T |
13873433 |
ggttcgattccctctggtgccaatttcggtaggctaagttcatacagagtttgctctagcttcaaacagggcccccgcaagtgggtggtggaattgatcc |
13873334 |
T |
 |
| Q |
241 |
cctcggattaatcgatta |
258 |
Q |
| |
|
|| |||||| ||||||| |
|
|
| T |
13873333 |
tctgggattagtcgatta |
13873316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 218 - 279
Target Start/End: Complemental strand, 17637912 - 17637852
Alignment:
| Q |
218 |
caagttggcggtgagattggtcccctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
||||| |||||||| |||||||||||||||||| |||||| || |||||||||||||||||| |
|
|
| T |
17637912 |
caagtgggcggtgatattggtcccctcggattagtcgattctt-gatcggataccgagtttt |
17637852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 141 - 278
Target Start/End: Complemental strand, 25969638 - 25969504
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
|||| ||||||| || ||| |||||| ||||| | ||||| |||||||| ||||| || |||||||| ||||||||| |||| |||||| ||||||| | |
|
|
| T |
25969638 |
ggttggattccccctggtgccaatttcggtggcc-aagtccatacagaacttgctctggctttaaac-gggcccccgtaagtgagcggtgggattggt-c |
25969542 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttt |
278 |
Q |
| |
|
||||| |||| |||||| ||| ||||||||| |||||| |
|
|
| T |
25969541 |
cctcgaattagtcgattcttgaatcggatactgagttt |
25969504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 226 - 279
Target Start/End: Original strand, 33289198 - 33289251
Alignment:
| Q |
226 |
cggtgagattggtcccctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
|||||||||| |||||||||||||| |||||| ||||||||||||||| ||||| |
|
|
| T |
33289198 |
cggtgagattagtcccctcggattagtcgattcttggatcggataccgggtttt |
33289251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 146 - 278
Target Start/End: Complemental strand, 20527166 - 20527035
Alignment:
| Q |
146 |
gattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcccctcg |
245 |
Q |
| |
|
|||||||||| | | |||||| ||||||||||||| ||| ||| ||| ||| ||||||| ||||||| | |||| |||||| |||||||| ||||| |
|
|
| T |
20527166 |
gattccctctggcgccaatttcggtgggctaagtccatatagagcttgatttcggtttaaacagggcccc-gtaagtgggcggtaggattggtctcctcg |
20527068 |
T |
 |
| Q |
246 |
gattaatcgattattggatcggataccgagttt |
278 |
Q |
| |
|
||||| |||||| ||||||| ||||||||||| |
|
|
| T |
20527067 |
gattagtcgatttttggatcaaataccgagttt |
20527035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 218 - 281
Target Start/End: Complemental strand, 23131497 - 23131434
Alignment:
| Q |
218 |
caagttggcggtgagattggtcccctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
||||| |||||| |||||||||||||| |||| |||||| || |||||||||||||||||||| |
|
|
| T |
23131497 |
caagtgggcggtaggattggtcccctcgaattagtcgattcttcgatcggataccgagttttca |
23131434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 212 - 275
Target Start/End: Complemental strand, 46759170 - 46759107
Alignment:
| Q |
212 |
cccccgcaagttggcggtgagattggtcccctcggattaatcgattattggatcggataccgag |
275 |
Q |
| |
|
||||||||| | | ||||||||||||| ||||||||||||||||| || |||||||||||||| |
|
|
| T |
46759170 |
cccccgcaaatagacggtgagattggttccctcggattaatcgatctttagatcggataccgag |
46759107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 141 - 279
Target Start/End: Original strand, 1985895 - 1986031
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||| | ||| ||||| | ||||||||||| ||||||| | || || |||||||||| |||||| ||||| ||||||| |||||| | |
|
|
| T |
1985895 |
ggttcgattccctttggtgcgaatttcgatgggctaagtccatacagagtaaactctggctttaaacggagcccccacaagtgggcggtggaattggt-c |
1985993 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
|||||||| |||||| |||||| |||||||||||||| |
|
|
| T |
1985994 |
tatcggattagtcgattcttggat-ggataccgagtttt |
1986031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 191 - 281
Target Start/End: Complemental strand, 4585799 - 4585711
Alignment:
| Q |
191 |
ttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcccctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||| ||||||| ||||||||| |||||||| |||||| || ||| ||| ||||| |||||| |
|
|
| T |
4585799 |
ttgctttggctttaaacggg-cccccgcaagtgggcggtg-gattggtcctttcggattagtcgattcttagattggacaccgatttttca |
4585711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 227 - 281
Target Start/End: Complemental strand, 43352391 - 43352337
Alignment:
| Q |
227 |
ggtgagattggtcccctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
||||||||||||| |||| |||||||||||| ||| ||| ||||||||||||||| |
|
|
| T |
43352391 |
ggtgagattggtctcctcagattaatcgattcttgaatcagataccgagttttca |
43352337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 209 - 278
Target Start/End: Complemental strand, 9646286 - 9646217
Alignment:
| Q |
209 |
gggcccccgcaagttggcggtgagattggtcccctcggattaatcgattattggatcggataccgagttt |
278 |
Q |
| |
|
||||| |||||||| ||| ||| ||||| ||||||||||||| ||| | |||||||||| |||||||||| |
|
|
| T |
9646286 |
gggccaccgcaagtgggcagtgggattgatcccctcggattagtcggtcattggatcgggtaccgagttt |
9646217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 141 - 177
Target Start/End: Complemental strand, 9693507 - 9693471
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaa |
177 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| |
|
|
| T |
9693507 |
ggttcgattccctctagtgtcaatttgggtgggctaa |
9693471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 205 - 281
Target Start/End: Original strand, 13017836 - 13017911
Alignment:
| Q |
205 |
aacggggcccccgcaagttggcggtgagattggtcccctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||| ||||||||||| ||| ||| ||||||||| ||||||||| ||| | ||||||| ||||||||||||||| |
|
|
| T |
13017836 |
aacgggacccccgcaagtgggcagtgggattggtccactcggattagtcggtccttggatc-gataccgagttttca |
13017911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 161 - 229
Target Start/End: Complemental strand, 29875893 - 29875825
Alignment:
| Q |
161 |
caattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggt |
229 |
Q |
| |
|
|||||| ||||||||||||| ||||||| ||| | |||||||||| || |||||||||||||||||| |
|
|
| T |
29875893 |
caatttcggtgggctaagtccatacagagcttgttctgactttaaatggaacccccgcaagttggcggt |
29875825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 142 - 177
Target Start/End: Complemental strand, 8030212 - 8030177
Alignment:
| Q |
142 |
gttcgattccctctagtgtcaattttggtgggctaa |
177 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |
|
|
| T |
8030212 |
gttcgattccctctagtgtcaatttgggtgggctaa |
8030177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 200 - 243
Target Start/End: Complemental strand, 22625140 - 22625097
Alignment:
| Q |
200 |
ctttaaacggggcccccgcaagttggcggtgagattggtcccct |
243 |
Q |
| |
|
||||||| ||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
22625140 |
ctttaaatggggcccccgcaagtgggcggtgggattggtcccct |
22625097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 229 - 279
Target Start/End: Original strand, 13781133 - 13781183
Alignment:
| Q |
229 |
tgagattggtcccctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||| |||||||| ||| |||| |
|
|
| T |
13781133 |
tgagattggtcccctcgaattaatcgattcttgaatcggatatcgaatttt |
13781183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 226 - 279
Target Start/End: Complemental strand, 3391499 - 3391446
Alignment:
| Q |
226 |
cggtgagattggtcccctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
|||||||||||||||||||| |||| ||| | |||| ||| ||||||||||||| |
|
|
| T |
3391499 |
cggtgagattggtcccctcgaattagtcggtcattgaatcagataccgagtttt |
3391446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 216 - 277
Target Start/End: Complemental strand, 21175719 - 21175658
Alignment:
| Q |
216 |
cgcaagttggcggtgagattggtcccctcggattaatcgattattggatcggataccgagtt |
277 |
Q |
| |
|
||||||| ||||||| |||||| |||| |||||| |||| |||||||||||||||||||| |
|
|
| T |
21175719 |
cgcaagtaggcggtggaattggttcccttagattaaacgatcattggatcggataccgagtt |
21175658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 318 - 355
Target Start/End: Complemental strand, 23985823 - 23985786
Alignment:
| Q |
318 |
ctaatcaagctactaactctagttaacctatcaactaa |
355 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
23985823 |
ctaaccaagctactaactctagtttacctatcaactaa |
23985786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 141 - 281
Target Start/End: Original strand, 28791174 - 28791313
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaa-tttgctttgactttaaacggggcccccgcaagttggcggtgagattggtc |
239 |
Q |
| |
|
||||| ||| ||||| |||||||||| |||||| |||||| ||||| || |||||| || ||||||||||| | || ||||| ||||||||||||||| |
|
|
| T |
28791174 |
ggttccattacctctggtgtcaatttcggtggg-taagtctatacaaaactttgctctggctttaaacgggtctcca-caagtgggcggtgagattggtt |
28791271 |
T |
 |
| Q |
240 |
ccctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
| ||| |||| ||| | ||| |||||||| |||||||||| |
|
|
| T |
28791272 |
ctttcgaattagtcggtccttgaatcggatatcgagttttca |
28791313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 218 - 279
Target Start/End: Original strand, 37302623 - 37302684
Alignment:
| Q |
218 |
caagttggcggtgagattggtcccctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
||||| |||| || |||||||||| |||||||| |||||| ||| |||||||||||| |||| |
|
|
| T |
37302623 |
caagtgggcgatgggattggtcccttcggattagtcgattcttgaatcggataccgaatttt |
37302684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 197 - 278
Target Start/End: Complemental strand, 42508463 - 42508382
Alignment:
| Q |
197 |
tgactttaaacggggcccccgcaagttggcggtgagattggtcccctcggattaatcgattattggatcggataccgagttt |
278 |
Q |
| |
|
|||||||||| ||| ||||| ||||| |||||| ||||||||||||| |||| ||| ||||| ||| |||||||||||| |
|
|
| T |
42508463 |
tgactttaaatgggccccccacaagtgggcggttgaattggtcccctcgaattagtcggttattagattagataccgagttt |
42508382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 135 - 188
Target Start/End: Complemental strand, 43719209 - 43719156
Alignment:
| Q |
135 |
gtttcgggttcgattccctctagtgtcaattttggtgggctaagtcaatacaga |
188 |
Q |
| |
|
||||| |||||||||| |||||||| ||||| ||||||||||||| ||||||| |
|
|
| T |
43719209 |
gtttcaggttcgattctctctagtgctaatttcggtgggctaagtccatacaga |
43719156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 318 - 355
Target Start/End: Original strand, 52545283 - 52545320
Alignment:
| Q |
318 |
ctaatcaagctactaactctagttaacctatcaactaa |
355 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
52545283 |
ctaaccaagctactaactctagtttacctatcaactaa |
52545320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 91; Significance: 5e-44; HSPs: 35)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 91; E-Value: 5e-44
Query Start/End: Original strand, 141 - 279
Target Start/End: Complemental strand, 654284 - 654146
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| ||| |||||| ||||||||||||| ||||||| ||||| || ||||||||||||| ||||||||| ||||||| ||||||||| |
|
|
| T |
654284 |
ggttcgattccctctggtgccaatttcggtgggctaagtccatacagagcttgctctggctttaaacggggctcccgcaagtgggcggtgggattggtcc |
654185 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
654184 |
cctcggattagtcgattattggatcggataccgagtttt |
654146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 89; E-Value: 8e-43
Query Start/End: Original strand, 141 - 281
Target Start/End: Complemental strand, 15360236 - 15360096
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| ||| |||||| ||||||||||||| ||||||| ||||| || ||||||||||||||||||||| | ||||||| ||||||||| |
|
|
| T |
15360236 |
ggttcgattccctctggtgccaatttcggtgggctaagtccatacagagcttgctctggctttaaacggggcccccgcaaatgggcggtgggattggtcc |
15360137 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
15360136 |
cctcggattagtcgattcttggatcggataccgagttttca |
15360096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 89; E-Value: 8e-43
Query Start/End: Original strand, 141 - 281
Target Start/End: Original strand, 34147405 - 34147545
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| ||| |||||| ||||||||||||| ||||||| ||||| || ||||||||||| ||||||||||| ||||||| ||||||||| |
|
|
| T |
34147405 |
ggttcgattccctctggtgccaatttcggtgggctaagtccatacagagcttgctctggctttaaacgggccccccgcaagtgggcggtgggattggtcc |
34147504 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
34147505 |
cctcggattagtcgattcttggatcggataccgagttttca |
34147545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 89; E-Value: 8e-43
Query Start/End: Original strand, 141 - 281
Target Start/End: Original strand, 34160021 - 34160161
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| ||| |||||| ||||||||||||| ||||||| ||||| || ||||||||||| ||||||||||| ||||||| ||||||||| |
|
|
| T |
34160021 |
ggttcgattccctctggtgccaatttcggtgggctaagtccatacagagcttgctctggctttaaacgggccccccgcaagtgggcggtgggattggtcc |
34160120 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
34160121 |
cctcggattagtcgattcttggatcggataccgagttttca |
34160161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 141 - 279
Target Start/End: Original strand, 28672126 - 28672264
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| ||||||| ||| |||| ||||||||||| ||| ||||||| ||||||| ||||||||| |
|
|
| T |
28672126 |
ggttcgattccctctggtgtcaattttggtgggctaagtccatacagagcttgttttggctttaaacgggcccctcgcaagtgggcggtgggattggtcc |
28672225 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
|||||||||| |||||| ||||||| ||||||||||||| |
|
|
| T |
28672226 |
cctcggattagtcgattcttggatcagataccgagtttt |
28672264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 141 - 281
Target Start/End: Complemental strand, 3222773 - 3222634
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| ||| |||||| ||||||||||||| ||||||| ||||| || |||||||||||||||| |||||| ||||||| ||||||||| |
|
|
| T |
3222773 |
ggttcgattccctctggtgccaatttcggtgggctaagtccatacagagcttgctctgtctttaaacggggcccc-gcaagtgggcggtgggattggtcc |
3222675 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
3222674 |
cctcggattagtcgattcttggatcggataccgagttttca |
3222634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 84; E-Value: 8e-40
Query Start/End: Original strand, 142 - 281
Target Start/End: Complemental strand, 21148647 - 21148509
Alignment:
| Q |
142 |
gttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtccc |
241 |
Q |
| |
|
|||||||||||||||||| |||||| | ||||||||||| ||||||| ||||| ||||||||||||||||||| |||||| ||||||| |||||||||| |
|
|
| T |
21148647 |
gttcgattccctctagtgccaatttcgatgggctaagtccatacagagcttgctctgactttaaacggggcccc-gcaagtgggcggtgggattggtccc |
21148549 |
T |
 |
| Q |
242 |
ctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
||||||||| |||||| ||| ||||||||||||||||||| |
|
|
| T |
21148548 |
ctcggattagtcgattcttgaatcggataccgagttttca |
21148509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 141 - 278
Target Start/End: Original strand, 9239034 - 9239171
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| ||| |||||| |||||| |||||| ||| ||| |||||||| ||||||| ||||||||||||||| ||||||| ||||||||| |
|
|
| T |
9239034 |
ggttcgattccctctggtgccaatttcggtgggttaagtccatatagagcttgctttggctttaaatggggcccccgcaagtgggcggtgggattggtcc |
9239133 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttt |
278 |
Q |
| |
|
|||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
9239134 |
cctcggattagtcgattcttggatcggataccgagttt |
9239171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 141 - 279
Target Start/End: Original strand, 11448930 - 11449068
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
|||||||||| |||| ||| |||||| ||||||||||||| ||||||| ||||| || ||||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
11448930 |
ggttcgattctctctggtgccaatttcggtgggctaagtccatacagagcttgctctggctttaaacggggcccccgcaagtgggcggtgggattggtcc |
11449029 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
|||||||||| |||||| ||| |||||||| |||||||| |
|
|
| T |
11449030 |
cctcggattagtcgattcttgaatcggatatcgagtttt |
11449068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 141 - 281
Target Start/End: Original strand, 9843997 - 9844137
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||| | ||||| ||||||||||||||||| |||||| ||||||| ||| | || ||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
9843997 |
ggttcgacttcctctggtgtcaattttggtgggttaagtccatacagagcttgttctggctttaaacggggccccctcaagtgggcggtgagattggtcc |
9844096 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
| |||||||| |||||| |||||||||||| |||||||||| |
|
|
| T |
9844097 |
cttcggattagtcgattcttggatcggatatcgagttttca |
9844137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 141 - 279
Target Start/End: Complemental strand, 5360209 - 5360071
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
|||||||||||||||| || |||||| ||||||||||||| ||||||| ||||| ||||||||||||| ||||| ||||| ||||||| ||||||||| |
|
|
| T |
5360209 |
ggttcgattccctctaatgccaatttcggtgggctaagtccatacagagcttgctctgactttaaacggaacccccacaagtgggcggtgggattggtcc |
5360110 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
||||| |||| |||||| || |||||||||||||||||| |
|
|
| T |
5360109 |
cctcgaattagtcgattcttagatcggataccgagtttt |
5360071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 141 - 279
Target Start/End: Complemental strand, 9690776 - 9690638
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||| | |||||||||||||| ||||||||||||| ||||||| ||||| || ||||||||||||||| | ||||| | ||||| ||||||||| |
|
|
| T |
9690776 |
ggttcgatttcttctagtgtcaatttcggtgggctaagtccatacagagcttgctctggctttaaacggggccctcacaagtggacggtgggattggtcc |
9690677 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
9690676 |
tctcggattagtcgattcttggatcggataccgagtttt |
9690638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 141 - 281
Target Start/End: Original strand, 12390484 - 12390621
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| ||| |||||| ||||||||||||| ||||||| ||||| || |||||||| |||||||||||||| ||||||| ||||||||| |
|
|
| T |
12390484 |
ggttcgattccctctggtgccaatttcggtgggctaagtccatacagagcttgctctggctttaaacagggcccccgcaagtgggcggtgggattggtcc |
12390583 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
12390584 |
cctcggattagtcgatta---aatcggataccgagttttca |
12390621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 141 - 281
Target Start/End: Original strand, 1344994 - 1345134
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| ||| |||||| |||||||||||| ||||| | ||||| || ||||||||||| ||||||||||| | ||||| ||||||||| |
|
|
| T |
1344994 |
ggttcgattccctctggtgccaatttcagtgggctaagtccatacaaagcttgctctggctttaaacgggccccccgcaagtggacggtgggattggtcc |
1345093 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
||| |||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
1345094 |
ccttggattagtcgattcttggatcggataccgagttttca |
1345134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 141 - 281
Target Start/End: Complemental strand, 21982458 - 21982319
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
|||||||||||| | ||| |||||| |||||||||||| ||||||| ||||| || ||||||||||||||||||||||| ||||||| ||||||| | |
|
|
| T |
21982458 |
ggttcgattcccgatggtgccaatttcagtgggctaagtccatacagagcttgctctggctttaaacggggcccccgcaagtgggcggtgggattggt-c |
21982360 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
21982359 |
cctcggattagtcgattcttggatcggataccgagttttca |
21982319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 146 - 281
Target Start/End: Complemental strand, 17081187 - 17081052
Alignment:
| Q |
146 |
gattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcccctcg |
245 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||||| ||||||| ||||| |||||||||| ||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
17081187 |
gattccctctggtgtcaatttcggtgggctaagtccatacagagcttgctctgactttaaatggggcccccgcaagtgggcggtgggattggtcccctcg |
17081088 |
T |
 |
| Q |
246 |
gattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|| | | | || |||||||| |||||||||||||| |
|
|
| T |
17081087 |
aataagttgtttcttggatcgaataccgagttttca |
17081052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 141 - 281
Target Start/End: Original strand, 11007224 - 11007364
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
|||||||||| |||| | ||||||| ||||||||||||| ||||| | ||||| | |||||| |||||||||||||||| ||||||| |||||| || |
|
|
| T |
11007224 |
ggttcgattcactctgctctcaatttcggtgggctaagtccatacaaagcttgctctagctttaagcggggcccccgcaagtgggcggtgggattggccc |
11007323 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||||||| |||||| || ||||||||||| |||||||| |
|
|
| T |
11007324 |
cctcggattagtcgattctttgatcggatacctagttttca |
11007364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 144 - 279
Target Start/End: Original strand, 11840963 - 11841097
Alignment:
| Q |
144 |
tcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcccct |
243 |
Q |
| |
|
|||||||||||| ||| |||||| |||||| |||||| ||||| | |||||||| ||||||||||||||| |||| | ||||| |||| ||||||| |
|
|
| T |
11840963 |
tcgattccctctggtgccaatttcggtgggttaagtccatacaaagcttgctttggttttaaacggggccccat-aagtggacggtgggattagtcccct |
11841061 |
T |
 |
| Q |
244 |
cggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
|| |||| |||||||||||||||||||||||||||| |
|
|
| T |
11841062 |
cgaattagtcgattattggatcggataccgagtttt |
11841097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 200 - 281
Target Start/End: Original strand, 14213000 - 14213081
Alignment:
| Q |
200 |
ctttaaacggggcccccgcaagttggcggtgagattggtcccctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||||||||| |||||||||| || |||| ||||||||| ||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
14213000 |
ctttaaacgggggccccgcaagtgggtggtgggattggtccactcggattagtcgattcttggatcggataccgagttttca |
14213081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 141 - 279
Target Start/End: Original strand, 9208311 - 9208449
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaat-ttgctttgactttaaacggggcccccgcaagttggcggtgagattggtc |
239 |
Q |
| |
|
|||||||||||| || ||| |||||| ||||||| ||||| ||||||| |||||||| ||||||| ||||||||||||||| ||||||| |||||||| |
|
|
| T |
9208311 |
ggttcgattccccctggtgccaatttcggtgggc-aagtccatacagagccttgctttggctttaaatggggcccccgcaagtgggcggtgggattggtc |
9208409 |
T |
 |
| Q |
240 |
ccctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
|||| || || |||||| ||||||| |||||||||||| |
|
|
| T |
9208410 |
tcctcagaatagtcgattcttggatcaaataccgagtttt |
9208449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 146 - 279
Target Start/End: Original strand, 33499539 - 33499672
Alignment:
| Q |
146 |
gattccctctagtgtcaattttggtgggctaagtcaatacagaa-tttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcccctc |
244 |
Q |
| |
|
|||||||||| |||||||||| ||||||||| ||| ||||| | ||||||||| ||||||| ||| || || ||||| ||||||| ||||||||||||| |
|
|
| T |
33499539 |
gattccctctggtgtcaatttcggtgggcta-gtccatacaaatctttgctttggctttaaatgggccctccacaagtgggcggtgggattggtcccctc |
33499637 |
T |
 |
| Q |
245 |
ggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
|||||| || || |||| ||||||||||||||| |
|
|
| T |
33499638 |
ggattagtcagttgatggaccggataccgagtttt |
33499672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 141 - 277
Target Start/End: Complemental strand, 17149594 - 17149458
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaat-ttgctttgactttaaacggggcccccgcaagttggcggtgagattggtc |
239 |
Q |
| |
|
||||||||||||||| ||| ||||| ||| ||| ||||| ||||||| |||||||| ||||||| ||||||||||||||| ||||| |||||||| |
|
|
| T |
17149594 |
ggttcgattccctctggtgctaatttcggttggc-aagtccatacagagccttgctttggctttaaatggggcccccgcaagtgaacggtgggattggtc |
17149496 |
T |
 |
| Q |
240 |
ccctcggattaatcgattattggatcggataccgagtt |
277 |
Q |
| |
|
|||||| |||| ||| | ||| ||| ||||||||||| |
|
|
| T |
17149495 |
ccctcgaattagtcggtccttgaatcagataccgagtt |
17149458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 188 - 281
Target Start/End: Complemental strand, 17706410 - 17706317
Alignment:
| Q |
188 |
aatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcccctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||||| || |||||||| |||||| ||||||| | ||||| ||||||| |||||||| | || ||| |||||||||||||||| |||||| |
|
|
| T |
17706410 |
aatttgctctggctttaaactgggccctcgcaagtggacggtgtgattggtttcctcggataagtcaattcttggatcggataccgaattttca |
17706317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 201 - 270
Target Start/End: Complemental strand, 33718547 - 33718478
Alignment:
| Q |
201 |
tttaaacggggcccccgcaagttggcggtgagattggtcccctcggattaatcgattattggatcggata |
270 |
Q |
| |
|
||||||||||||| | |||||| | ||||| ||||| ||||||||||||| |||||| |||||||||||| |
|
|
| T |
33718547 |
tttaaacggggcctctgcaagtggacggtgggattgatcccctcggattagtcgattcttggatcggata |
33718478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 143 - 243
Target Start/End: Complemental strand, 28968178 - 28968078
Alignment:
| Q |
143 |
ttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcccc |
242 |
Q |
| |
|
|||||||| |||||| |||||||| |||||| |||||| |||||||| || || || |||||||||| |||| | || | ||||||| ||||||||||| |
|
|
| T |
28968178 |
ttcgattctctctagcgtcaatttcggtgggttaagtccatacagaacttactctgcctttaaacggtgcccatgtaaataggcggtgggattggtcccc |
28968079 |
T |
 |
| Q |
243 |
t |
243 |
Q |
| |
|
| |
|
|
| T |
28968078 |
t |
28968078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 141 - 277
Target Start/End: Original strand, 10377774 - 10377911
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaa-tttgctttgactttaaacggggcccccg-caagttggcggtgagattggt |
238 |
Q |
| |
|
||||| ||||||| | ||| |||||| ||||||| ||||| ||||| | |||||| |||||| ||||||||||||| ||||| ||||||| |||||| |
|
|
| T |
10377774 |
ggttcaattccctatggtgccaatttcggtgggc-aagtccatacatagctttgctctgacttaaaacggggccccccacaagtgggcggtggcattggt |
10377872 |
T |
 |
| Q |
239 |
cccctcggattaatcgattattggatcggataccgagtt |
277 |
Q |
| |
|
||||||||| || ||| | |||||| |||||||||||| |
|
|
| T |
10377873 |
cccctcggagtagtcggtccttggattggataccgagtt |
10377911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 141 - 211
Target Start/End: Original strand, 12591696 - 12591766
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacgggg |
211 |
Q |
| |
|
||||||||||||||| ||| |||||| |||||||||||| ||||||| ||||| || |||||||||||| |
|
|
| T |
12591696 |
ggttcgattccctctcgtgccaatttcagtgggctaagtccatacagagcttgctctggctttaaacgggg |
12591766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 201 - 279
Target Start/End: Complemental strand, 14504160 - 14504082
Alignment:
| Q |
201 |
tttaaacggggcccccgcaagttggcggtgagattggtcccctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
|||||| |||| |||||||||| ||||||| ||||| ||| |||| |||| ||||| ||| ||||||||||||||||| |
|
|
| T |
14504160 |
tttaaatggggtccccgcaagtgggcggtgggattgatcctctcgaattagtcgatccttgtatcggataccgagtttt |
14504082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 141 - 177
Target Start/End: Original strand, 20213108 - 20213144
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaa |
177 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| |
|
|
| T |
20213108 |
ggttcgattccctctagtgtcaatttgggtgggctaa |
20213144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 141 - 177
Target Start/End: Original strand, 22107131 - 22107167
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaa |
177 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| |
|
|
| T |
22107131 |
ggttcgattccctctagtgtcaatttgggtgggctaa |
22107167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 200 - 281
Target Start/End: Complemental strand, 21903699 - 21903617
Alignment:
| Q |
200 |
ctttaaacggggcccccgcaagttggcggtgagattggtcccc-tcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
||||||| ||||| || |||||| ||||||| || |||||||| || ||||| |||||| ||||||||||| | ||||||||| |
|
|
| T |
21903699 |
ctttaaatggggcaccagcaagtgggcggtgggaatggtccccctcagattagtcgattcttggatcggatgcagagttttca |
21903617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 146 - 240
Target Start/End: Original strand, 31039084 - 31039177
Alignment:
| Q |
146 |
gattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||| ||||||| | ||||||||||| ||||||| |||||| || || | || || ||||| ||||| ||||||| ||||||||| |
|
|
| T |
31039084 |
gattccctctagtatcaatttcgatgggctaagtccatacagagtttgctatggctatgaa-tggacccccacaagtgggcggtgtgattggtcc |
31039177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 318 - 355
Target Start/End: Complemental strand, 33866148 - 33866111
Alignment:
| Q |
318 |
ctaatcaagctactaactctagttaacctatcaactaa |
355 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
33866148 |
ctaaccaagctactaactctagtttacctatcaactaa |
33866111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 318 - 355
Target Start/End: Complemental strand, 33869295 - 33869258
Alignment:
| Q |
318 |
ctaatcaagctactaactctagttaacctatcaactaa |
355 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
33869295 |
ctaaccaagctactaactctagtttacctatcaactaa |
33869258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 217 - 281
Target Start/End: Original strand, 4391489 - 4391553
Alignment:
| Q |
217 |
gcaagttggcggtgagattggtcccctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||| ||||||| ||| |||||| | ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
4391489 |
gcaagtgggcggtggacttgatccccttgtattaatcgattattgaatcgaataccgagttttca |
4391553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0576 (Bit Score: 89; Significance: 8e-43; HSPs: 1)
Name: scaffold0576
Description:
Target: scaffold0576; HSP #1
Raw Score: 89; E-Value: 8e-43
Query Start/End: Original strand, 141 - 281
Target Start/End: Complemental strand, 5220 - 5080
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| ||| |||||| ||||||||||||| ||||||| ||||| || ||||||||||||||||||||| | ||||||| ||||||||| |
|
|
| T |
5220 |
ggttcgattccctctggtgccaatttcggtgggctaagtccatacagagcttgctctggctttaaacggggcccccgcaaatgggcggtgggattggtcc |
5121 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
5120 |
cctcggattagtcgattcttggatcggataccgagttttca |
5080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 89; Significance: 8e-43; HSPs: 62)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 89; E-Value: 8e-43
Query Start/End: Original strand, 141 - 281
Target Start/End: Complemental strand, 44946191 - 44946051
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||| | ||| |||||| ||||||||||||| |||||||| ||||| || ||||||||||| ||||||||||| ||||||| ||||||||| |
|
|
| T |
44946191 |
ggttcgattccctttggtgccaatttcggtgggctaagtccatacagaacttgctctggctttaaacgggccccccgcaagtgggcggtgggattggtcc |
44946092 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
44946091 |
cctcggattagtcgattcttggatcggataccgagttttca |
44946051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 141 - 281
Target Start/End: Original strand, 15038018 - 15038158
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||| | ||| |||||| ||||||||||||| ||||||| |||||||| |||||||||| |||||||||||| ||||||| ||||||||| |
|
|
| T |
15038018 |
ggttcgattccctttggtgccaatttcggtgggctaagtccatacagagcttgctttggctttaaacggagcccccgcaagtgggcggtgggattggtcc |
15038117 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||| ||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
15038118 |
cctcagattagtcgattcttggatcggataccgagttttca |
15038158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 141 - 281
Target Start/End: Original strand, 35171859 - 35171999
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| | |||||| ||||||||||||| ||||||| ||||| || ||||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
35171859 |
ggttcgattccctctggcaccaatttcggtgggctaagtccatacagagcttgctctggctttaaacggggcccccgcaagtgggcggtgggattggtcc |
35171958 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||||||| |||||| ||| ||||||||||||||||||| |
|
|
| T |
35171959 |
cctcggattagtcgattcttgaatcggataccgagttttca |
35171999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 141 - 281
Target Start/End: Complemental strand, 36242450 - 36242310
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| |||||||||| ||||||||||||| | |||| ||||| || |||||||||||| |||||||||| ||||||| ||||||||| |
|
|
| T |
36242450 |
ggttcgattccctctggtgtcaatttcggtgggctaagtccagccagagcttgctctggctttaaacggggtccccgcaagtgggcggtgggattggtcc |
36242351 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
||||||||||||||||| |||||||||||||| | |||||| |
|
|
| T |
36242350 |
cctcggattaatcgattcttggatcggataccaaattttca |
36242310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 141 - 279
Target Start/End: Complemental strand, 11941348 - 11941210
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||| ||||||| | ||| ||||||||||||| |||||| ||||||| ||||| || ||||||||||| ||||||||||| ||||||| ||||||||| |
|
|
| T |
11941348 |
ggttcaattccctatggtgccaattttggtgggttaagtccatacagagcttgctctggctttaaacgggacccccgcaagtgggcggtgggattggtcc |
11941249 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
11941248 |
cctcggattagtcgattcttggatcggataccgagtttt |
11941210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 161 - 281
Target Start/End: Original strand, 28668952 - 28669072
Alignment:
| Q |
161 |
caattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcccctcggattaatcgattatt |
260 |
Q |
| |
|
|||||| ||||| ||||||| ||||||| |||||||| ||||||||||||||||| ||||| ||||||| ||||||||||||||||||| |||||| || |
|
|
| T |
28668952 |
caatttcggtggactaagtccatacagagcttgctttggctttaaacggggcccccacaagtgggcggtgggattggtcccctcggattagtcgattttt |
28669051 |
T |
 |
| Q |
261 |
ggatcggataccgagttttca |
281 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
28669052 |
ggatcggataccgagttttca |
28669072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 141 - 281
Target Start/End: Complemental strand, 33827711 - 33827571
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| ||| |||||| | ||||||||||| ||||||| ||||| || ||||||||||| |||| |||||| ||||||| ||||||||| |
|
|
| T |
33827711 |
ggttcgattccctctggtgccaatttcgttgggctaagtccatacagagcttgctctggctttaaacgggacccctgcaagtgggcggtgggattggtcc |
33827612 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
||| |||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
33827611 |
ccttggattagtcgattcttggatcggataccgagttttca |
33827571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 135 - 281
Target Start/End: Original strand, 24196057 - 24196201
Alignment:
| Q |
135 |
gtttcgggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagat |
234 |
Q |
| |
|
||||| ||||||||||||||| ||| ||||| ||||||||||||| |||||||| ||||| || ||||||||||| |||||||||| ||||||| ||| |
|
|
| T |
24196057 |
gtttcaggttcgattccctctggtgcaaatttcggtgggctaagtccatacagaacttgctctggctttaaacggg--ccccgcaagtgggcggtgggat |
24196154 |
T |
 |
| Q |
235 |
tggtcccctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||||||||||||| |||||| || ||| |||||||||||||||| |
|
|
| T |
24196155 |
tggtcccctcggattagtcgattttttgattggataccgagttttca |
24196201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 141 - 281
Target Start/End: Original strand, 41314051 - 41314190
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| |||||||||| ||||||||||||| ||||||| ||||| ||||||||||| ||| ||||||||| | ||||| ||||||||| |
|
|
| T |
41314051 |
ggttcgattccctctggtgtcaatttcggtgggctaagtctatacagagcttgctctgactttaaac-gggatcccgcaagtggacggtgggattggtcc |
41314149 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||| |||||||||||| || ||||||||||| |||||||| |
|
|
| T |
41314150 |
cctcagattaatcgattcttcgatcggataccaagttttca |
41314190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 141 - 279
Target Start/End: Complemental strand, 30466968 - 30466830
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
|||||||||| |||| || |||||| ||||||||||||| ||||||| ||||| || |||||||| |||||||||||||| ||| ||| ||||||||| |
|
|
| T |
30466968 |
ggttcgattctctctgctgccaatttcggtgggctaagtccatacagagcttgctctggctttaaaccgggcccccgcaagtgggcagtgggattggtcc |
30466869 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
| |||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
30466868 |
cttcggattagtcgattcttggatcggataccgagtttt |
30466830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 141 - 281
Target Start/End: Complemental strand, 2140621 - 2140484
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggccccc-gcaagttggcggtgagattggtc |
239 |
Q |
| |
|
||||||||||||||| |||||||||| ||||| |||| ||||||| ||||| || ||||||| ||| ||||| |||||| ||||||| |||||||| |
|
|
| T |
2140621 |
ggttcgattccctctggtgtcaatttcggtgg----agtccatacagagcttgctctggctttaaatgggcccccccgcaagtgggcggtgggattggtc |
2140526 |
T |
 |
| Q |
240 |
ccctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
2140525 |
ccctcggattagtcgattattggatcggataccgagttttca |
2140484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 141 - 281
Target Start/End: Original strand, 5394076 - 5394216
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| |||||||||| | ||||||||||| ||||||| |||||| |||||||||| |||||| |||||||| ||||||| ||||||||| |
|
|
| T |
5394076 |
ggttcgattccctctggtgtcaatttcgatgggctaagtccatacagagtttgctctgactttaaatggggccgccgcaagtgggcggtgggattggtcc |
5394175 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||||| ||| | || ||||||||||||| |||||| |
|
|
| T |
5394176 |
gttcggattagtcggtccttagatcggataccgaattttca |
5394216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 142 - 279
Target Start/End: Original strand, 19849893 - 19850029
Alignment:
| Q |
142 |
gttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtccc |
241 |
Q |
| |
|
|||||||||| | |||||||||||||| ||| ||||||| ||||||| ||||| || |||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
19849893 |
gttcgattccttttagtgtcaattttgatggactaagtctatacagagcttgctctggctttaaacagggcccccgcaagtgggcggtgagattggtcct |
19849992 |
T |
 |
| Q |
242 |
ctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
||| ||||||||||| ||||||| ||||| ||||||| |
|
|
| T |
19849993 |
ctcaaattaatcgattcttggatc-gatactgagtttt |
19850029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 141 - 257
Target Start/End: Complemental strand, 44976292 - 44976175
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggc-ccccgcaagttggcggtgagattggtc |
239 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||||||| ||||||| |||||| || ||||||||||||| |||||||||| ||||||| ||||| || |
|
|
| T |
44976292 |
ggttcgattccctctggtgccaattttggtgggctaagtccatacagagtttgctctggctttaaacggggctccccgcaagtgggcggtgggattgatc |
44976193 |
T |
 |
| Q |
240 |
ccctcggattaatcgatt |
257 |
Q |
| |
|
|| |||||||| |||||| |
|
|
| T |
44976192 |
ccttcggattagtcgatt |
44976175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 143 - 279
Target Start/End: Original strand, 41329904 - 41330039
Alignment:
| Q |
143 |
ttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcccc |
242 |
Q |
| |
|
||||||||||||| ||| ||||||||| |||||||||| ||| ||| ||||| || ||||||| ||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
41329904 |
ttcgattccctctggtgccaattttggcgggctaagtccata-agagcttgctctggctttaaatggggcccccacaagtgggcggtgagattggtcccc |
41330002 |
T |
 |
| Q |
243 |
tcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
|| ||||| ||| || ||||| ||||||||||||||| |
|
|
| T |
41330003 |
tcagattagtcggttcttggaccggataccgagtttt |
41330039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 143 - 281
Target Start/End: Original strand, 3943801 - 3943939
Alignment:
| Q |
143 |
ttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcccc |
242 |
Q |
| |
|
||||||| |||| ||| |||||| ||| ||||||||| ||||||| ||||| || ||||||||||||| ||||||||| || |||| ||||||||||| |
|
|
| T |
3943801 |
ttcgattttctctggtgccaatttcggttggctaagtccatacagagcttgctctggctttaaacggggctcccgcaagtgggtggtgggattggtcccc |
3943900 |
T |
 |
| Q |
243 |
tcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
| |||||| ||| ||||||||||||||||| |||||||| |
|
|
| T |
3943901 |
ttggattagtcggttattggatcggataccaagttttca |
3943939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 141 - 281
Target Start/End: Original strand, 8258956 - 8259096
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| | ||||||||||||| |||||| ||||||| ||| | || |||||| |||||||||||||||| ||||||| |||| || | |
|
|
| T |
8258956 |
ggttcgattccctctgacgccaattttggtgggttaagtccatacagatcttgttctggctttaatcggggcccccgcaagtaggcggtgggattagttc |
8259055 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
| |||||||| |||||| ||||||||||||| ||||||||| |
|
|
| T |
8259056 |
cttcggattagtcgattcttggatcggatactgagttttca |
8259096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 162 - 281
Target Start/End: Complemental strand, 34516530 - 34516412
Alignment:
| Q |
162 |
aattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcccctcggattaatcgattattg |
261 |
Q |
| |
|
||||| ||||||||||||| ||||||| ||||| | ||||||||||| |||| |||||| ||||||| ||||||||||||||||||| |||||| ||| |
|
|
| T |
34516530 |
aatttcggtgggctaagtccatacagagcttgctctcgctttaaacggg-cccctgcaagtgggcggtgggattggtcccctcggattagtcgattcttg |
34516432 |
T |
 |
| Q |
262 |
gatcggataccgagttttca |
281 |
Q |
| |
|
||||||||||| |||||||| |
|
|
| T |
34516431 |
gatcggataccaagttttca |
34516412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 157 - 279
Target Start/End: Complemental strand, 27269466 - 27269344
Alignment:
| Q |
157 |
gtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcccctcggattaatcgat |
256 |
Q |
| |
|
|||||||||| ||||||||||||| ||| |||| ||||| || |||||||| | | ||||||||| ||||||| ||||| ||||||||||||| ||||| |
|
|
| T |
27269466 |
gtgtcaatttcggtgggctaagtccatatagaacttgctctggctttaaacagccctcccgcaagtgggcggtgggattgatcccctcggattagtcgat |
27269367 |
T |
 |
| Q |
257 |
tattggatcggataccgagtttt |
279 |
Q |
| |
|
| |||||| |||||||||||||| |
|
|
| T |
27269366 |
tcttggataggataccgagtttt |
27269344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 141 - 281
Target Start/End: Original strand, 19054084 - 19054225
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccc-cgcaagttggcggtgagattggtc |
239 |
Q |
| |
|
|||| |||||| ||| |||| || || ||||||||||||| ||||||| |||||||| ||||||| || |||| ||||||| ||||||| |||||||| |
|
|
| T |
19054084 |
ggtttgattccttctggtgttaacttcggtgggctaagtccatacagagcttgctttggctttaaatggaaccccccgcaagtgggcggtgggattggtc |
19054183 |
T |
 |
| Q |
240 |
ccctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
| ||||||||| |||||| ||||||| ||||||||||||||| |
|
|
| T |
19054184 |
cgctcggattagtcgattcttggatcagataccgagttttca |
19054225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 141 - 281
Target Start/End: Complemental strand, 43374463 - 43374328
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| ||| |||||| |||||||||||| ||||| | ||||| || |||||| |||||||||||| |||||| ||||||||| |
|
|
| T |
43374463 |
ggttcgattccctctggtgccaatttcggtgggctaagtttatacaaagcttgctctggctttaa-----gcccccgcaagtgagcggtgggattggtcc |
43374369 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
| |||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
43374368 |
cttcggattagtcgattcttggatcggataccgagttttca |
43374328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 161 - 279
Target Start/End: Complemental strand, 714243 - 714125
Alignment:
| Q |
161 |
caattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcccctcggattaatcgattatt |
260 |
Q |
| |
|
|||||| ||||||||||||| ||| ||| |||||| ||||||||||||| |||||||||| | ||||||| | || |||||||| ||||| |||||| || |
|
|
| T |
714243 |
caatttcggtgggctaagtccatagagagtttgctctgactttaaacggagcccccgcaaatgggcggtgggtttcgtcccctcagattagtcgattctt |
714144 |
T |
 |
| Q |
261 |
ggatcggataccgagtttt |
279 |
Q |
| |
|
||| |||||||||||||| |
|
|
| T |
714143 |
agattggataccgagtttt |
714125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 141 - 279
Target Start/End: Original strand, 25293225 - 25293356
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccc-cgcaagttggcggtgagattggtc |
239 |
Q |
| |
|
||||||||||||||| ||| |||||| |||||||||||| ||| ||| || |||||||||||||||| ||||||| |||| || |||||||| |
|
|
| T |
25293225 |
ggttcgattccctctggtgccaatttcggtgggctaagttcata--------gctctggctttaaacggggccccccgcaagtgggcgatgggattggtc |
25293316 |
T |
 |
| Q |
240 |
ccctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
||||||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
25293317 |
ccctcggattagtcgattcttggatcggataccgagtttt |
25293356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 141 - 279
Target Start/End: Complemental strand, 36390706 - 36390569
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||| ||||| ||| |||||| ||||| ||||||| ||||| | ||||| |||||||||| ||| ||||||||||| ||||||| ||||||| | |
|
|
| T |
36390706 |
ggttcgatttcctctggtgccaatttcggtggactaagtccatacaaagcttgctctgactttaaatgggacccccgcaagtgggcggtgggattggt-c |
36390608 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
|||||||| | ||||| ||| ||||||||||||||||| |
|
|
| T |
36390607 |
cctcggatcagtcgatacttgaatcggataccgagtttt |
36390569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 141 - 279
Target Start/End: Original strand, 17324825 - 17324961
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| ||| |||||| ||||||||||||| ||||||| ||||| || ||||||| |||||||| ||||| ||||||| |||| |||| |
|
|
| T |
17324825 |
ggttcgattccctctggtgccaatttcggtgggctaagtccatacagagcttgctctggctttaaa-tgggcccccacaagtgggcggtgggattagtcc |
17324923 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
|||| |||| |||||| || ||||||||| |||||||| |
|
|
| T |
17324924 |
cctcaaattagtcgattctt-gatcggatatcgagtttt |
17324961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 141 - 281
Target Start/End: Original strand, 1191572 - 1191712
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
|||||| ||||||||||| |||||| ||||||||||||| ||||||| |||||| || |||||||||| | ||||| |||| ||||| |||| ||| |
|
|
| T |
1191572 |
ggttcgtttccctctagtaccaatttcggtgggctaagtccatacagagtttgctctggctttaaacggtgtccccgaaagtgaacggtggaattgttcc |
1191671 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
||||| |||| |||||| ||||| || ||||||| |||||| |
|
|
| T |
1191672 |
cctcgaattagtcgattcttggaccgaataccgaattttca |
1191712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 143 - 275
Target Start/End: Complemental strand, 5608170 - 5608038
Alignment:
| Q |
143 |
ttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcccc |
242 |
Q |
| |
|
|||||||| |||| |||||||||||||||||||||||| ||| ||| ||||| ||||||||||||| || ||| ||| | | ||| | ||||| |||| |
|
|
| T |
5608170 |
ttcgattctctctggtgtcaattttggtgggctaagtccatatagagcttgctctgactttaaacggagctcccacaaatggtcggcgggattgatccct |
5608071 |
T |
 |
| Q |
243 |
tcggattaatcgattattggatcggataccgag |
275 |
Q |
| |
|
|| ||| | |||||||||| ||||||||||||| |
|
|
| T |
5608070 |
tcagatgagtcgattattgaatcggataccgag |
5608038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 141 - 279
Target Start/End: Complemental strand, 10582128 - 10581995
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| ||| |||||| ||||||||||||| ||||||| ||||| | |||||||| |||||| ||||||| ||| ||| ||||||||| |
|
|
| T |
10582128 |
ggttcgattccctctggtgccaatttcggtgggctaagtccatacagagcttgctctagctttaaac-gggccctcgcaagtgggc-gtgggattggtcc |
10582031 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
||||| |||| ||||||| ||||||||||||||||| |
|
|
| T |
10582030 |
cctcgaattagtcgatta---aatcggataccgagtttt |
10581995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 205 - 281
Target Start/End: Original strand, 14486948 - 14487024
Alignment:
| Q |
205 |
aacggggcccccgcaagttggcggtgagattggtcccctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
||||||||||| |||||| ||||||| ||||||||||||||||||| ||| | ||||||||||||||||||||||| |
|
|
| T |
14486948 |
aacggggcccctgcaagtgggcggtgggattggtcccctcggattagtcggtccttggatcggataccgagttttca |
14487024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 142 - 279
Target Start/End: Original strand, 13266550 - 13266686
Alignment:
| Q |
142 |
gttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtccc |
241 |
Q |
| |
|
||||||||| |||| ||| ||||| ||||| ||||||| ||||||| ||||| || |||||||||||| |||||||||| || || |||||||||| |
|
|
| T |
13266550 |
gttcgattcactctggtgccaattccggtggactaagtccatacagagcttgctctggctttaaacgggg-ccccgcaagtgggtaatgggattggtccc |
13266648 |
T |
 |
| Q |
242 |
ctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
||| |||| |||||| |||||||||||| |||||||| |
|
|
| T |
13266649 |
ctcaaattagtcgattcttggatcggatatcgagtttt |
13266686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 212 - 281
Target Start/End: Original strand, 18692090 - 18692159
Alignment:
| Q |
212 |
cccccgcaagttggcggtgagattggtcccctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
||||| ||||| ||||||| |||||||||||||| |||| |||||| ||||||||||||||||||||||| |
|
|
| T |
18692090 |
cccccacaagtgggcggtgggattggtcccctcgtattagtcgattcttggatcggataccgagttttca |
18692159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 202 - 279
Target Start/End: Complemental strand, 44929923 - 44929846
Alignment:
| Q |
202 |
ttaaacggggcccccgcaagttggcggtgagattggtcccctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
||||||||| ||||||||||| | ||||| |||||||||||| | |||| |||||| ||||||||||||||||||||| |
|
|
| T |
44929923 |
ttaaacgggacccccgcaagtggacggtgggattggtccccttgaattagtcgattcttggatcggataccgagtttt |
44929846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 191 - 279
Target Start/End: Original strand, 31778140 - 31778228
Alignment:
| Q |
191 |
ttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcccctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
||||| || ||||||| ||||||||||||||| | ||||||||||||||| ||| ||||| || || ||||||||||||||||||||| |
|
|
| T |
31778140 |
ttgctctggctttaaatggggcccccgcaagtggacggtgagattggtcctctcagattagtcagttcttggatcggataccgagtttt |
31778228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 200 - 272
Target Start/End: Original strand, 45132405 - 45132477
Alignment:
| Q |
200 |
ctttaaacggggcccccgcaagttggcggtgagattggtcccctcggattaatcgattattggatcggatacc |
272 |
Q |
| |
|
||||||||||||||||| ||||| ||| || ||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
45132405 |
ctttaaacggggcccccacaagtgggcagtaggattggtcctctcggattaatcgattcttggatcggatacc |
45132477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 141 - 281
Target Start/End: Complemental strand, 4567575 - 4567427
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcg--------gtgag |
232 |
Q |
| |
|
||||||||| ||||| ||| |||||| |||||||||| || ||||||| ||| | || ||||||||||||||||| ||||| |||| ||| | |
|
|
| T |
4567575 |
ggttcgatttcctctggtgccaatttcggtgggctaaatccatacagagcttgttctggctttaaacggggcccccacaagtgggcggtgggattgtggg |
4567476 |
T |
 |
| Q |
233 |
attggtcccctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||||| ||||||||| || ||| |||||||||||||| |||||||| |
|
|
| T |
4567475 |
attggtcctctcggattagtcaattcttggatcggatacccagttttca |
4567427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 200 - 279
Target Start/End: Complemental strand, 6714374 - 6714295
Alignment:
| Q |
200 |
ctttaaacggggcccccgcaagttggcggtgagattggtcccctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
||||||||||| | ||||||||| | ||||||||||||||||||| |||| |||||| |||||| |||||||||||||| |
|
|
| T |
6714374 |
ctttaaacgggactcccgcaagtggacggtgagattggtcccctcaaattagtcgattcttggattggataccgagtttt |
6714295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 213 - 280
Target Start/End: Complemental strand, 18976521 - 18976454
Alignment:
| Q |
213 |
ccccgcaagttggcggtgagattggtcccctcggattaatcgattattggatcggataccgagttttc |
280 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||| |||| |||||| |||||||||||||||| ||||| |
|
|
| T |
18976521 |
ccccgcaagtgggcggtgggattggtcccctcgaattagtcgattcttggatcggataccgaattttc |
18976454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 201 - 279
Target Start/End: Original strand, 4852649 - 4852726
Alignment:
| Q |
201 |
tttaaacggggcccccgcaagttggcggtgagattggtcccctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
||||||||||||||| |||||| | ||||| ||||||||||||||||||||||||| ||||||||||| || |||||| |
|
|
| T |
4852649 |
tttaaacggggcccc-gcaagtggacggtggaattggtcccctcggattaatcgattcttggatcggatgccaagtttt |
4852726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 142 - 272
Target Start/End: Original strand, 45271444 - 45271574
Alignment:
| Q |
142 |
gttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtccc |
241 |
Q |
| |
|
|||||||||||||| ||| |||||| |||||||||||| ||||||| ||||| || ||||||||| ||||| |||||| |||| ||||||| |||| |
|
|
| T |
45271444 |
gttcgattccctctggtgccaatttcagtgggctaagtccatacagagcttgctctggctttaaacgaagcccctgcaagtgagcggagagattgatccc |
45271543 |
T |
 |
| Q |
242 |
ctcggattaatcgattattggatcggatacc |
272 |
Q |
| |
|
||| |||| |||||| || ||| ||||||| |
|
|
| T |
45271544 |
ctcaaattagtcgattctttgattggatacc |
45271574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 141 - 281
Target Start/End: Original strand, 27290647 - 27290773
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||| ||| |||||| ||||||||||||| ||||||| ||||| || ||||||||||| ||||||||||| |||| |
|
|
| T |
27290647 |
ggttcgattcccttcggtgccaatttcggtgggctaagtccatacagagcttgctctggctttaaacgggccccccgcaagt--------------gtcc |
27290732 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
27290733 |
cctcggattagtcgattcttggatcggataccgagttttca |
27290773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 205 - 281
Target Start/End: Complemental strand, 28194212 - 28194136
Alignment:
| Q |
205 |
aacggggcccccgcaagttggcggtgagattggtcccctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||| | || ||||| ||| | ||||||||||||||||||||||| |
|
|
| T |
28194212 |
aacggggcccccgcaagtaggcggtgggattggtctcgtcagattagtcggtccttggatcggataccgagttttca |
28194136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 175 - 270
Target Start/End: Original strand, 4769259 - 4769354
Alignment:
| Q |
175 |
taagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcccctcggattaatcgattattggatcggata |
270 |
Q |
| |
|
|||||| ||||||| ||||| || |||||||||||| |||||||||| | ||||||| ||||||||||| |||| |||||| || ||||||||| |
|
|
| T |
4769259 |
taagtccatacagagcttgctctggctttaaacgggggccccgcaagtggacggtgaggttggtcccctcaaattagtcgattcttagatcggata |
4769354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 200 - 279
Target Start/End: Original strand, 44610157 - 44610236
Alignment:
| Q |
200 |
ctttaaacggggcccccgcaagttggcggtgagattggtcccctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
||||||| |||||||| |||||| ||||||| |||||||||| |||||||| ||| || ||||| || |||||||||||| |
|
|
| T |
44610157 |
ctttaaatggggcccctgcaagtgggcggtgggattggtcccatcggattagtcggttcttggaccgaataccgagtttt |
44610236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 215 - 281
Target Start/End: Original strand, 39957891 - 39957957
Alignment:
| Q |
215 |
ccgcaagttggcggtgagattggtcccctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||||| |||| || ||||||| ||||||||||| |||||| |||||| |||||||||||||||| |
|
|
| T |
39957891 |
ccgcaagtgggcgatgggattggttccctcggattagtcgattcttggattggataccgagttttca |
39957957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 216 - 281
Target Start/End: Complemental strand, 8192415 - 8192350
Alignment:
| Q |
216 |
cgcaagttggcggtgagattggtcccctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
||||||| ||||||| |||||| |||||||||||| ||| | ||||||||||||||||||||||| |
|
|
| T |
8192415 |
cgcaagtgggcggtgggattgggcccctcggattagtcggtccttggatcggataccgagttttca |
8192350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 214 - 279
Target Start/End: Original strand, 13089012 - 13089077
Alignment:
| Q |
214 |
cccgcaagttggcggtgagattggtcccctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
||||||||| ||||||||||||||||| ||| ||||| ||| || |||| |||||||||||||||| |
|
|
| T |
13089012 |
cccgcaagtgggcggtgagattggtcctctcagattattcggtttttgggtcggataccgagtttt |
13089077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 200 - 279
Target Start/End: Complemental strand, 9401040 - 9400961
Alignment:
| Q |
200 |
ctttaaacggggcccccgcaagttggcggtgagattggtcccctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
|||||||| |||||||||||||| ||| ||| ||||||| ||| ||||| |||||| ||||||||||||| ||||||| |
|
|
| T |
9401040 |
ctttaaacagggcccccgcaagtgggcagtgggattggtttccttagattagtcgattcttggatcggatactgagtttt |
9400961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 225 - 279
Target Start/End: Complemental strand, 12360350 - 12360296
Alignment:
| Q |
225 |
gcggtgagattggtcccctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
||||||||||||||| |||||||||| ||||| |||||||||||||||| |||| |
|
|
| T |
12360350 |
gcggtgagattggtctcctcggattagtcgatctttggatcggataccgaatttt |
12360296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 232 - 281
Target Start/End: Complemental strand, 1501510 - 1501462
Alignment:
| Q |
232 |
gattggtcccctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
||||||||||||||||||| |||||| || |||||||||||||||||||| |
|
|
| T |
1501510 |
gattggtcccctcggattagtcgattctt-gatcggataccgagttttca |
1501462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 141 - 250
Target Start/End: Complemental strand, 19525534 - 19525429
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctt-tgactttaaacggggcccccgcaagttggcggtgagattggtc |
239 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||| ||||| ||||| |||| || ||||||| | ||||||||||||| || ||||||||||||| |
|
|
| T |
19525534 |
ggttcgattccctctggtgccaattttggtgggc-aagtccatacaa----tgctaatggctttaaatgaggcccccgcaagtgggtggtgagattggtc |
19525440 |
T |
 |
| Q |
240 |
ccctcggatta |
250 |
Q |
| |
|
|||| |||||| |
|
|
| T |
19525439 |
cccttggatta |
19525429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 8 - 68
Target Start/End: Complemental strand, 16381847 - 16381787
Alignment:
| Q |
8 |
ctatatggaatcattcctcagatttgcttcttgaaaggaatttctgtatttccaaaggtaa |
68 |
Q |
| |
|
||||||||||| ||||||| ||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
16381847 |
ctatatggaattgttcctcaactttgcttcttgcaaggaatacctgtatttccaaaggtaa |
16381787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 242 - 281
Target Start/End: Original strand, 11147227 - 11147266
Alignment:
| Q |
242 |
ctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
11147227 |
ctcggattaatcgattttttgatcggataccgagttttca |
11147266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 224 - 279
Target Start/End: Original strand, 19174904 - 19174959
Alignment:
| Q |
224 |
ggcggtgagattggtcccctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
||||||| ||||| ||||||||||||||||| | |||||||||||||||| |||| |
|
|
| T |
19174904 |
ggcggtgggattgatcccctcggattaatcggtccttggatcggataccgaatttt |
19174959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 141 - 279
Target Start/End: Complemental strand, 19605983 - 19605846
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaat-ttgctttgactttaaacggggcccccgcaagttggcggtgagattggtc |
239 |
Q |
| |
|
|||||||||||||||| || ||||| ||||||| ||||| ||||||| | ||||| | |||| || |||| ||| ||||| |||||||||||||||| |
|
|
| T |
19605983 |
ggttcgattccctctaatgctaatttcggtgggc-aagtccatacagagtcttgctctcacttagaaagggggccca-caagtgggcggtgagattggtc |
19605886 |
T |
 |
| Q |
240 |
ccctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
|||||| |||| | || |||||||||||| |||||||| |
|
|
| T |
19605885 |
ccctcgaattagttgacacttggatcggatatcgagtttt |
19605846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 200 - 279
Target Start/End: Original strand, 29361667 - 29361745
Alignment:
| Q |
200 |
ctttaaacggggcccccgcaagttggcggtgagattggtcccctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
|||||||||| ||||| |||||| ||| ||| ||||| || |||||||||||| |||| ||||||||||| |||||||| |
|
|
| T |
29361667 |
ctttaaacggagcccc-gcaagtgggcagtgggattgatctcctcggattaattgattcctggatcggatatcgagtttt |
29361745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 134 - 185
Target Start/End: Original strand, 32845143 - 32845194
Alignment:
| Q |
134 |
agtttcgggttcgattccctctagtgtcaattttggtgggctaagtcaatac |
185 |
Q |
| |
|
|||||| ||||||||||||||| ||| |||||| ||||||||||||| |||| |
|
|
| T |
32845143 |
agtttcaggttcgattccctctggtgccaatttcggtgggctaagtccatac |
32845194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 141 - 211
Target Start/End: Original strand, 19517001 - 19517071
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacgggg |
211 |
Q |
| |
|
||||||||| ||| | ||| ||||||| ||||||||||| ||||||| |||||||| |||||||||||| |
|
|
| T |
19517001 |
ggttcgatttcctatgctgttaattttgatgggctaagtccatacagagcttgctttggctttaaacgggg |
19517071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 190 - 279
Target Start/End: Complemental strand, 13599413 - 13599325
Alignment:
| Q |
190 |
tttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcccctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
|||||| |||||| ||||||||||| |||||| | ||||||||||| ||||||| |||| | | | ||||||||||||||||| |||| |
|
|
| T |
13599413 |
tttgctctgacttagaacggggcccc-gcaagtggacggtgagattgatcccctcatattagtgggtcattggatcggataccgaatttt |
13599325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 233 - 281
Target Start/End: Complemental strand, 1845095 - 1845047
Alignment:
| Q |
233 |
attggtcccctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||||||||| |||| |||||| |||| |||||||||||||||||| |
|
|
| T |
1845095 |
attggtcccctcaaattagtcgattcttggctcggataccgagttttca |
1845047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 141 - 177
Target Start/End: Complemental strand, 21195685 - 21195649
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaa |
177 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||||| |
|
|
| T |
21195685 |
ggttcgattccctctagtgtcaatttggatgggctaa |
21195649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 141 - 177
Target Start/End: Original strand, 39765000 - 39765036
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaa |
177 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||||| |
|
|
| T |
39765000 |
ggttcgattccctctagtgtcaatttagctgggctaa |
39765036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 142 - 210
Target Start/End: Complemental strand, 40997487 - 40997419
Alignment:
| Q |
142 |
gttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggg |
210 |
Q |
| |
|
|||| |||||| ||||| |||||| |||| | |||||||||||||| ||||| |||||||||||||| |
|
|
| T |
40997487 |
gttcaattccccctagtaccaatttcggtgagataagtcaatacagagcttgctctgactttaaacggg |
40997419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 89; Significance: 8e-43; HSPs: 63)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 89; E-Value: 8e-43
Query Start/End: Original strand, 141 - 281
Target Start/End: Complemental strand, 4621375 - 4621235
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| ||| |||||| ||||||||||||| ||||||| ||||| || |||||||||||| |||||||||| ||||||| ||||||||| |
|
|
| T |
4621375 |
ggttcgattccctctggtgccaatttcggtgggctaagtccatacagagcttgctctggctttaaacggggtccccgcaagtgggcggtgggattggtcc |
4621276 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
4621275 |
cctcggattagtcgattcttggatcggataccgagttttca |
4621235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 141 - 279
Target Start/End: Original strand, 24122082 - 24122220
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| ||| |||||| ||||||||||||| ||||||| ||||| || ||||||||||||| ||||||||| ||||||| ||||||||| |
|
|
| T |
24122082 |
ggttcgattccctctggtgccaatttcggtgggctaagtccatacagagcttgctctggctttaaacggggctcccgcaagtgggcggtgggattggtcc |
24122181 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
24122182 |
cctcggattagtcgattcttggatcggataccgagtttt |
24122220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 141 - 278
Target Start/End: Original strand, 17935828 - 17935965
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||| ||||||| |||||| ||||||||||||| ||||||| |||||| || ||||||||||||||||||||||| |||| || ||||||||| |
|
|
| T |
17935828 |
ggttcgattccttctagtgccaatttcggtgggctaagtccatacagagtttgctctggctttaaacggggcccccgcaagtgggcgatgggattggtcc |
17935927 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttt |
278 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
17935928 |
actcggattagtcgattcttggatcggataccgagttt |
17935965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 141 - 281
Target Start/End: Complemental strand, 7766865 - 7766725
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| ||| ||||| ||||||||||||| ||||||| ||||| |||||||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
7766865 |
ggttcgattccctctggtgctaatttcggtgggctaagtccatacagagcttgctctgactttaaacggggcccccgcaagtgggcggtgggattggtcc |
7766766 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||||||| |||||| ||| |||||||| |||||||||| |
|
|
| T |
7766765 |
cctcggattagtcgattcttgaatcggatatcgagttttca |
7766725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 141 - 281
Target Start/End: Complemental strand, 15059540 - 15059400
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
|||||||||| |||| ||| |||||| ||||||||||||| ||||||| ||||| || |||||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
15059540 |
ggttcgattctctctggtgccaatttcggtgggctaagtccatacagagcttgctctggctttaaacggggtccccgcaagtgggcggtgagattggtcc |
15059441 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
||||| |||| |||||| ||||||||||||||||||||||| |
|
|
| T |
15059440 |
cctcgaattagtcgattcttggatcggataccgagttttca |
15059400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 141 - 279
Target Start/End: Original strand, 24674452 - 24674590
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| ||| |||||| ||||||||||||| ||||||| ||||| || ||||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
24674452 |
ggttcgattccctctggtgccaatttcggtgggctaagtccatacagagcttgctctggctttaaacggggcccccgcaagtgggcggtgggattggtcc |
24674551 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
||||| |||| |||||| |||||||||||||||| |||| |
|
|
| T |
24674552 |
cctcgtattagtcgattcttggatcggataccgaatttt |
24674590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 141 - 277
Target Start/End: Original strand, 8077706 - 8077841
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
|||||||||| |||| ||| |||||| ||||||||||||| ||||||| ||||| || |||||||| |||||||||||||| ||||||| ||||||||| |
|
|
| T |
8077706 |
ggttcgattctctctggtgccaatttcggtgggctaagtccatacagagcttgctctggctttaaacagggcccccgcaagtgggcggtgggattggtcc |
8077805 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagtt |
277 |
Q |
| |
|
|||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
8077806 |
cctc-gattaatcgattattggatcggagaccgagtt |
8077841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 141 - 279
Target Start/End: Complemental strand, 7197384 - 7197247
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| || |||||| |||||| |||||||||||||| ||||| || ||||||||| |||||| |||||| ||||||||||||||||| |
|
|
| T |
7197384 |
ggttcgattccctctgatgccaatttcggtggg-taagtcaatacagaccttgctctggctttaaacgaggcccctgcaagtgggcggtgagattggtcc |
7197286 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
|||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
7197285 |
cctcggattagtcgattcatggatcggataccgagtttt |
7197247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 142 - 275
Target Start/End: Original strand, 1378958 - 1379090
Alignment:
| Q |
142 |
gttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtccc |
241 |
Q |
| |
|
|||||||| ||||| |||||||||| ||||||||||||| |||||||| ||||| || ||||||||||| ||||||||||| | |||||||||||||||| |
|
|
| T |
1378958 |
gttcgatttcctctggtgtcaatttcggtgggctaagtccatacagaacttgctctggctttaaacggg-cccccgcaagtggacggtgagattggtccc |
1379056 |
T |
 |
| Q |
242 |
ctcggattaatcgattattggatcggataccgag |
275 |
Q |
| |
|
||| ||||| |||||| || |||||||||||||| |
|
|
| T |
1379057 |
ctcagattagtcgattcttagatcggataccgag |
1379090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 141 - 281
Target Start/End: Original strand, 23734175 - 23734316
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacgggg-cccccgcaagttggcggtgagattggtc |
239 |
Q |
| |
|
||||||||||||||| || |||||| ||||||||||||| ||||||| |||||| || |||||||||||| ||||||||||| |||||||| ||||||| |
|
|
| T |
23734175 |
ggttcgattccctctgatgccaatttcggtgggctaagtccatacagagtttgctatgcctttaaacggggccccccgcaagtgggcggtgaaattggtc |
23734274 |
T |
 |
| Q |
240 |
ccctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
||||| ||||| |||||| ||| |||||||||| |||||||| |
|
|
| T |
23734275 |
ccctcagattagtcgattcttgaatcggataccaagttttca |
23734316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 141 - 281
Target Start/End: Original strand, 23741367 - 23741508
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacgggg-cccccgcaagttggcggtgagattggtc |
239 |
Q |
| |
|
||||||||||||||| || |||||| ||||||||||||| ||||||| |||||| || |||||||||||| ||||||||||| |||||||| ||||||| |
|
|
| T |
23741367 |
ggttcgattccctctgatgccaatttcggtgggctaagtccatacagagtttgctatgcctttaaacggggccccccgcaagtgggcggtgaaattggtc |
23741466 |
T |
 |
| Q |
240 |
ccctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
||||| ||||| |||||| ||| |||||||||| |||||||| |
|
|
| T |
23741467 |
ccctcagattagtcgattcttgaatcggataccaagttttca |
23741508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 141 - 281
Target Start/End: Original strand, 7578468 - 7578608
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||| | ||| |||||| ||||||||||||| ||||| | ||||| |||||||||||||||||| ||||||| || |||| ||||||| | |
|
|
| T |
7578468 |
ggttcgattccctatggtgccaatttcggtgggctaagtccatacaaagcttgctctgactttaaacggggccctcgcaagtgggtggtgggattggttc |
7578567 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||||||| | |||| ||||||||||||||||||||||| |
|
|
| T |
7578568 |
cctcggattagttgatttttggatcggataccgagttttca |
7578608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 141 - 281
Target Start/End: Complemental strand, 8254890 - 8254750
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||| |||| |||||||||| |||||||||||| |||||||| ||||| || ||||||||||||||||||||||| ||||||| ||||| ||| |
|
|
| T |
8254890 |
ggttcgattatctctggtgtcaatttcggtgggctaagttcatacagaacttgctctggctttaaacggggcccccgcaagtgggcggtgggattgatcc |
8254791 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
||| | |||| |||||| ||| ||||||||||||||||||| |
|
|
| T |
8254790 |
ccttgaattagtcgattcttgaatcggataccgagttttca |
8254750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 141 - 279
Target Start/End: Complemental strand, 9500493 - 9500355
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
|||||||||| |||| ||| |||||| ||||||||||||| ||||||| ||||| || |||||||||| |||||| ||||| |||||||||||||||| |
|
|
| T |
9500493 |
ggttcgattctctctggtgccaatttcggtgggctaagtccatacagagcttgctctggctttaaacggagcccccacaagtgggcggtgagattggtct |
9500394 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
| |||||||| |||||| |||||||||||| |||||||| |
|
|
| T |
9500393 |
cttcggattagtcgattcttggatcggatatcgagtttt |
9500355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 141 - 281
Target Start/End: Original strand, 30677235 - 30677375
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
|||| |||||||||| ||| |||||| ||||||||||||| ||||||| |||||||| ||||||| ||| ||||||||||| ||||||| ||||||||| |
|
|
| T |
30677235 |
ggtttgattccctctggtgccaatttcggtgggctaagtccatacagagcttgctttggctttaaatgggacccccgcaagtgggcggtgggattggtcc |
30677334 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||| ||||| ||| || ||||| |||||| |||||||||| |
|
|
| T |
30677335 |
cctcagattagtcggttcttggaccggatatcgagttttca |
30677375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 141 - 281
Target Start/End: Original strand, 46607869 - 46608009
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| ||| |||||| ||||||||||||| ||||||| ||||| |||||||||| || ||||||||||| ||||||| ||||| ||| |
|
|
| T |
46607869 |
ggttcgattccctctggtgccaatttcggtgggctaagtccatacagagcttgctctgactttaaaaggcccccccgcaagtgggcggtgggattgatcc |
46607968 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||||||| ||| | |||||||||||| |||||||||| |
|
|
| T |
46607969 |
cctcggattagtcggtccttggatcggatatcgagttttca |
46608009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 141 - 278
Target Start/End: Original strand, 34778401 - 34778535
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
|||| |||||||||| || ||||||||||||| | || ||||||| ||||||||| ||||||||||||||||||||||| | ||||| ||||||||| |
|
|
| T |
34778401 |
ggtttgattccctctggtaccaattttggtgggtt---tccatacagagtttgctttggctttaaacggggcccccgcaagtggacggtgggattggtcc |
34778497 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttt |
278 |
Q |
| |
|
||| |||||| |||||| |||||||||||||||||||| |
|
|
| T |
34778498 |
ccttggattagtcgattcttggatcggataccgagttt |
34778535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 141 - 279
Target Start/End: Complemental strand, 45859181 - 45859043
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| ||| |||||| ||||||||||||| ||||| ||||| | |||||||| |||||||||||||| || ||| ||||||||| |
|
|
| T |
45859181 |
ggttcgattccctctggtgccaatttcggtgggctaagtccatacatcgcttgctcttgctttaaacagggcccccgcaagtgggtggtaggattggtcc |
45859082 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
|||||||||| | ||||||||||||||||||||| |||| |
|
|
| T |
45859081 |
cctcggattagttgattattggatcggataccgaatttt |
45859043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 141 - 274
Target Start/End: Original strand, 18646912 - 18647045
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
|||||||||| |||| ||| |||||| ||||||||||||| ||||| | |||||| || |||||||||| ||||| | |||| ||||||||||||| ||| |
|
|
| T |
18646912 |
ggttcgattctctctggtgccaatttcggtgggctaagtctatacaaagtttgctctggctttaaacggagcccctgtaagtgggcggtgagattgatcc |
18647011 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccga |
274 |
Q |
| |
|
||||| |||| |||||| ||| |||||||||||| |
|
|
| T |
18647012 |
cctcgaattagtcgattcttgaatcggataccga |
18647045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 143 - 271
Target Start/End: Complemental strand, 8779872 - 8779744
Alignment:
| Q |
143 |
ttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcccc |
242 |
Q |
| |
|
||||||| | |||||||||||||| ||||||||||||| ||||| | || || | ||||||||||||||||| ||||| ||||||| ||||||||||| |
|
|
| T |
8779872 |
ttcgatttcttctagtgtcaatttcggtgggctaagtccatacacagcttactctagctttaaacggggcccccacaagtaggcggtgggattggtcccc |
8779773 |
T |
 |
| Q |
243 |
tcggattaatcgattattggatcggatac |
271 |
Q |
| |
|
|||||||| |||||| || |||||||||| |
|
|
| T |
8779772 |
tcggattagtcgattcttagatcggatac |
8779744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 141 - 281
Target Start/End: Complemental strand, 33905648 - 33905508
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| || ||||||| |||||| |||||| ||||||| |||| | || |||||||||||||| ||| |||| | ||||| ||||| ||| |
|
|
| T |
33905648 |
ggttcgattccctctggtatcaatttcggtgggttaagtccatacagagtttgttctggctttaaacggggcctccgtaagtggacggtgggattgatcc |
33905549 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||| ||| ||||||| || |||||||||||||||||||| |
|
|
| T |
33905548 |
cctcaaatttatcgattctttgatcggataccgagttttca |
33905508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 141 - 281
Target Start/End: Complemental strand, 27455004 - 27454862
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggccccc--gcaagttggcggtgagattggt |
238 |
Q |
| |
|
|||||||||| |||| || |||||| |||| |||||||| ||||||| ||||| || ||||||||||| ||||| ||| || ||||||| ||||||| |
|
|
| T |
27455004 |
ggttcgattcactctgatgccaatttcggtgagctaagtccatacagagcttgctctggctttaaacgggccccccccgcatgtgggcggtgggattggt |
27454905 |
T |
 |
| Q |
239 |
cccctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||||||||| |||||| |||||||||||||| |||||||| |
|
|
| T |
27454904 |
cccctcggattagtcgattcttggatcggatacctagttttca |
27454862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 161 - 279
Target Start/End: Complemental strand, 45331740 - 45331621
Alignment:
| Q |
161 |
caattttggtgggctaagtcaatacagaatttgctttgactttaaacggggc-ccccgcaagttggcggtgagattggtcccctcggattaatcgattat |
259 |
Q |
| |
|
|||||| ||||||||||||| ||||||| |||||||| ||||||||||||| |||||||||| | ||||| |||| ||||||| |||||||||||| | |
|
|
| T |
45331740 |
caatttcggtgggctaagtccatacagagcttgctttggctttaaacggggctccccgcaagtggacggtgggattaatcccctcagattaatcgattct |
45331641 |
T |
 |
| Q |
260 |
tggatcggataccgagtttt |
279 |
Q |
| |
|
|| ||||||||||||||||| |
|
|
| T |
45331640 |
tgaatcggataccgagtttt |
45331621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 141 - 279
Target Start/End: Complemental strand, 36156026 - 36155888
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| ||| |||||| ||||||| ||||| || |||| ||||||| ||||||| ||||||||||| || ||||||| ||||||||| |
|
|
| T |
36156026 |
ggttcgattccctctggtgccaatttcggtgggccaagtccatgcagagcttgctttagttttaaacagggcccccgcaggtgggcggtgggattggtcc |
36155927 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
| || |||| |||||| ||||||||||||||||||||| |
|
|
| T |
36155926 |
cttcaaattagtcgattcttggatcggataccgagtttt |
36155888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 141 - 281
Target Start/End: Original strand, 32729604 - 32729743
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||| | ||| |||||| ||||||| ||||| ||||||| ||||| || ||||||| |||| |||||||||| ||||||| ||||| ||| |
|
|
| T |
32729604 |
ggttcgattccctatggtgccaatttcggtgggc-aagtccatacagagcttgctctggctttaaatggggtccccgcaagtgggcggtgggattgatcc |
32729702 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
||| |||||| ||| | ||||||||||||||||||||||| |
|
|
| T |
32729703 |
ccttggattagtcggtctttggatcggataccgagttttca |
32729743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 191 - 281
Target Start/End: Original strand, 22909980 - 22910070
Alignment:
| Q |
191 |
ttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcccctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
||||| ||||||||||||| |||||||||||| ||||||| |||| |||||||||||||| ||||| || |||||||||||||||||||| |
|
|
| T |
22909980 |
ttgctctgactttaaacggagcccccgcaagtgggcggtgggatttgtcccctcggattagtcgatacttcgatcggataccgagttttca |
22910070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 146 - 279
Target Start/End: Complemental strand, 18533857 - 18533724
Alignment:
| Q |
146 |
gattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcccctcg |
245 |
Q |
| |
|
||||| |||||||| |||||| | ||| ||||||| ||| ||| ||| | ||||||||||||||||||| |||||| ||| ||| ||||||||||||| |
|
|
| T |
18533857 |
gattctctctagtgccaatttcgatggactaagtccatatagagcttgttctgactttaaacggggcccctgcaagtgggccgtgggattggtcccctca |
18533758 |
T |
 |
| Q |
246 |
gattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
||||||||||| || ||||||||||| |||||| |
|
|
| T |
18533757 |
tattaatcgattcttagatcggataccaagtttt |
18533724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 141 - 271
Target Start/End: Complemental strand, 40146024 - 40145889
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggccc-----ccgcaagttggcggtgagatt |
235 |
Q |
| |
|
||||||||| ||||||||| |||||| |||||||||||| ||||||| ||||| |||||||||| ||| ||| || ||||| || |||||| || |
|
|
| T |
40146024 |
ggttcgatttcctctagtgccaatttatgtgggctaagtccatacagagcttgctctgactttaaatgggcccccacaaccacaagtgggtggtgagttt |
40145925 |
T |
 |
| Q |
236 |
ggtcccctcggattaatcgattattggatcggatac |
271 |
Q |
| |
|
||||||||||||||| |||||| ||||||||||||| |
|
|
| T |
40145924 |
ggtcccctcggattagtcgattcttggatcggatac |
40145889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 141 - 250
Target Start/End: Original strand, 168260 - 168369
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| ||| |||||| |||||||||||| ||||||| ||| | |||||||||||||| | ||||| ||| | ||||| ||||||||| |
|
|
| T |
168260 |
ggttcgattccctctggtgccaatttcggtgggctaagttcatacagagcttgttctgactttaaacgggactcccgctagtggccggtgggattggtcc |
168359 |
T |
 |
| Q |
241 |
cctcggatta |
250 |
Q |
| |
|
|||||||||| |
|
|
| T |
168360 |
cctcggatta |
168369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 200 - 281
Target Start/End: Original strand, 48699877 - 48699958
Alignment:
| Q |
200 |
ctttaaacggggcccccgcaagttggcggtgagattggtcccctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||||||| |||||||||||| ||||||| ||||| |||| |||||||| |||||| |||||||||||| |||||||||| |
|
|
| T |
48699877 |
ctttaaacggagcccccgcaagtgggcggtgggattgttcccttcggattagtcgattcttggatcggatatcgagttttca |
48699958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 142 - 250
Target Start/End: Original strand, 7946904 - 7947011
Alignment:
| Q |
142 |
gttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtccc |
241 |
Q |
| |
|
|||||||||||||| ||| |||||| ||||||||||||| ||||||| ||||| | ||||||| |||| |||||||||| || ||||||||||||||| |
|
|
| T |
7946904 |
gttcgattccctctggtgccaatttcggtgggctaagtctatacagagcttgctctcgctttaaatgggg-ccccgcaagtgggtggtgagattggtccc |
7947002 |
T |
 |
| Q |
242 |
ctcggatta |
250 |
Q |
| |
|
||| ||||| |
|
|
| T |
7947003 |
ctcagatta |
7947011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 191 - 279
Target Start/End: Complemental strand, 26513235 - 26513148
Alignment:
| Q |
191 |
ttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcccctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
||||| |||||||||||||| ||||| ||||| ||||||| || |||||||||||||||| |||||| |||||||| |||||||||||| |
|
|
| T |
26513235 |
ttgctctgactttaaacggg-cccccacaagtgggcggtgggaatggtcccctcggattagtcgattcttggatcgaataccgagtttt |
26513148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 142 - 274
Target Start/End: Original strand, 32930809 - 32930941
Alignment:
| Q |
142 |
gttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtccc |
241 |
Q |
| |
|
|||||||| ||||| ||| | |||||||||||||||||| || |||| ||||| || |||||||||||| ||| |||||| | |||| ||||| |||| |
|
|
| T |
32930809 |
gttcgatttcctctggtgcccattttggtgggctaagtccatgcagagcttgctctggctttaaacggggtccctgcaagtggatggtgggattgatccc |
32930908 |
T |
 |
| Q |
242 |
ctcggattaatcgattattggatcggataccga |
274 |
Q |
| |
|
||| |||||||||||| || ||| ||||||||| |
|
|
| T |
32930909 |
ctcagattaatcgattcttagattggataccga |
32930941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 200 - 281
Target Start/End: Complemental strand, 12877015 - 12876937
Alignment:
| Q |
200 |
ctttaaacggggcccccgcaagttggcggtgagattggtcccctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
||||||||||||||||||||||| | ||||| ||||||||||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
12877015 |
ctttaaacggggcccccgcaagtggacggtgggattggtcccctcggattaatggatta---aatcggataccgagttttca |
12876937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 141 - 274
Target Start/End: Original strand, 21726788 - 21726921
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||| | ||| |||||| | |||| |||||| ||| ||| ||| | | ||||||||||| ||||| ||||| ||||||| | ||| ||| |
|
|
| T |
21726788 |
ggttcgattccctttggtgccaatttcgatgggttaagtccatatagagcttgttctagctttaaacgggtcccccacaagtgggcggtggggttgatcc |
21726887 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccga |
274 |
Q |
| |
|
|||| |||||||||||| |||||||||||||||| |
|
|
| T |
21726888 |
cctcagattaatcgattcttggatcggataccga |
21726921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 141 - 281
Target Start/End: Original strand, 2272403 - 2272543
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
|||| |||||||||| || |||||| | |||||||||| ||||| | |||||| ||||||||||||||||||| |||| |||||| ||||| ||| |
|
|
| T |
2272403 |
ggtttgattccctctgatgccaatttcgctgggctaagttcatacaaagtttgctctgactttaaacggggcccctacaagggggcggtaggattgatcc |
2272502 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
| |||||||| |||||| | |||||||||| ||||||||| |
|
|
| T |
2272503 |
catcggattagtcgattctaagatcggatactgagttttca |
2272543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 200 - 279
Target Start/End: Original strand, 50202664 - 50202742
Alignment:
| Q |
200 |
ctttaaacggggcccccgcaagttggcggtgagattggtcccctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
||||||||||| ||| ||||||| ||||||| ||||||||||||||||||||||||| || ||||||||| |||||||| |
|
|
| T |
50202664 |
ctttaaacgggaccctcgcaagtgggcggtggaattggtcccctcggattaatcgattctt-gatcggatatcgagtttt |
50202742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 200 - 278
Target Start/End: Complemental strand, 37351531 - 37351454
Alignment:
| Q |
200 |
ctttaaacggggcccccgcaagttggcggtgagattggtcccctcggattaatcgattattggatcggataccgagttt |
278 |
Q |
| |
|
||||||||||| ||||| ||||| ||||||| ||||||||||||||||||| ||| | |||||||||||||||||||| |
|
|
| T |
37351531 |
ctttaaacggg-cccccacaagtgggcggtgggattggtcccctcggattagtcggtccttggatcggataccgagttt |
37351454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 233 - 281
Target Start/End: Original strand, 14603947 - 14603995
Alignment:
| Q |
233 |
attggtcccctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
14603947 |
attggtcccctcggattagtcgattcttggatcggataccgagttttca |
14603995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 209 - 281
Target Start/End: Original strand, 27159212 - 27159284
Alignment:
| Q |
209 |
gggcccccgcaagttggcggtgagattggtcccctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||||||||||| | ||||| ||||||||||||| ||||| ||||| |||||||||||| |||||||||| |
|
|
| T |
27159212 |
gggcccccgcaagtggacggtgggattggtcccctcagattagtcgatctttggatcggatatcgagttttca |
27159284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 191 - 250
Target Start/End: Original strand, 2537802 - 2537861
Alignment:
| Q |
191 |
ttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcccctcggatta |
250 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||| ||||| | ||||||||||||||||||| |
|
|
| T |
2537802 |
ttgctttggctttaaacgggccccccgcaagtgggcggagggattggtcccctcggatta |
2537861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 176 - 279
Target Start/End: Complemental strand, 40802171 - 40802069
Alignment:
| Q |
176 |
aagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcccctcggattaatcgattattggatcggataccgag |
275 |
Q |
| |
|
||||| ||||||| ||||| |||||||||||||| |||| |||||| || |||||||||||||| || | |||| |||||| ||| |||| |||||||| |
|
|
| T |
40802171 |
aagtccatacagagcttgctctgactttaaacgggtcccc-gcaagtgggtggtgagattggtcctctagaattagtcgattcttgaatcgaataccgag |
40802073 |
T |
 |
| Q |
276 |
tttt |
279 |
Q |
| |
|
|||| |
|
|
| T |
40802072 |
tttt |
40802069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 141 - 279
Target Start/End: Original strand, 1486477 - 1486617
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaa-tttgctttgactttaaacggggcccc--cgcaagttggcggtgagattgg |
237 |
Q |
| |
|
||||||||||||| | ||| |||||| | |||| |||||| ||||||| |||||| |||||| ||||||||||| ||||||| | ||||| ||| || |
|
|
| T |
1486477 |
ggttcgattccctttggtgccaatttcgatggg-taagtccatacagagctttgctctgacttagaacggggcccccccgcaagtggacggtgggatcgg |
1486575 |
T |
 |
| Q |
238 |
tcccctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
||||||| ||||| ||| | ||||||||||||||||||||| |
|
|
| T |
1486576 |
tcccctccgattagtcggtccttggatcggataccgagtttt |
1486617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 182 - 279
Target Start/End: Original strand, 1818809 - 1818905
Alignment:
| Q |
182 |
atacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcccctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
||||||| |||||||| ||||||||||| ||||||||||| || | |||||||| | |||||||| || ||||||||||||||||||||||||| |
|
|
| T |
1818809 |
atacagagcttgctttggctttaaacggg-cccccgcaagtaggtgacatgattggtcacatcggattagtcaattattggatcggataccgagtttt |
1818905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 210 - 279
Target Start/End: Original strand, 23041650 - 23041719
Alignment:
| Q |
210 |
ggcccccgcaagttggcggtgagattggtcccctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
|||| |||||||| | | ||| |||||||||||||| |||| |||||| ||||||||||||||||||||| |
|
|
| T |
23041650 |
ggcctccgcaagtggacagtgggattggtcccctcgaattagtcgattcttggatcggataccgagtttt |
23041719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 203 - 279
Target Start/End: Original strand, 6776201 - 6776277
Alignment:
| Q |
203 |
taaacggggcccccgcaagttggcggtgagattggtcccctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
|||||||||||||||||||| ||||||| |||| ||| ||| ||||| |||||||||| |||| ||||||| |||| |
|
|
| T |
6776201 |
taaacggggcccccgcaagtaggcggtggaattgatccactcagattagtcgattattgtatcgaataccgaatttt |
6776277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 143 - 279
Target Start/End: Original strand, 26820248 - 26820384
Alignment:
| Q |
143 |
ttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcccc |
242 |
Q |
| |
|
||||||||||| | |||||||||| |||| |||||| |||||||| ||||| || ||||||| ||| |||| |||||| | |||| |||| || | |
|
|
| T |
26820248 |
ttcgattccctatgatgtcaatttttatgggttaagtccatacagaacttgctctgcctttaaatgggacccctgcaagtggatggtggaattgatcgct |
26820347 |
T |
 |
| Q |
243 |
tcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
|||||||| |||||| |||||| | |||||||||||| |
|
|
| T |
26820348 |
tcggattagtcgattcttggattgaataccgagtttt |
26820384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 232 - 279
Target Start/End: Original strand, 5315481 - 5315528
Alignment:
| Q |
232 |
gattggtcccctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
||||||||||||||||| | |||||| ||||||||||||||||||||| |
|
|
| T |
5315481 |
gattggtcccctcggataagtcgattcttggatcggataccgagtttt |
5315528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 212 - 279
Target Start/End: Original strand, 35138118 - 35138185
Alignment:
| Q |
212 |
cccccgcaagttggcggtgagattggtcccctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
||||||||||| ||||||| ||||| | ||||||||||| ||| | ||||||||||||||||||||| |
|
|
| T |
35138118 |
cccccgcaagtgggcggtgggattgattccctcggattagtcggtccttggatcggataccgagtttt |
35138185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 141 - 250
Target Start/End: Original strand, 16899562 - 16899671
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaa-tttgctttgactttaaacggggcccccgcaagttggcggtgagattggtc |
239 |
Q |
| |
|
||||||||||||||| ||| |||||| ||||||| | ||| ||||| | |||||| || || ||||||||||| |||||| | |||||||||||||| |
|
|
| T |
16899562 |
ggttcgattccctctggtgccaatttcggtgggcca-gtccatacaaagctttgctctggtttagaacggggcccctgcaagtggacggtgagattggtc |
16899660 |
T |
 |
| Q |
240 |
ccctcggatta |
250 |
Q |
| |
|
||||||||||| |
|
|
| T |
16899661 |
ccctcggatta |
16899671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 141 - 177
Target Start/End: Original strand, 6122861 - 6122897
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaa |
177 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| |
|
|
| T |
6122861 |
ggttcgattccctctagtgtcaatttgggtgggctaa |
6122897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 135 - 240
Target Start/End: Complemental strand, 23232409 - 23232300
Alignment:
| Q |
135 |
gtttcgggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaattt----gctttgactttaaacggggcccccgcaagttggcggtg |
230 |
Q |
| |
|
||||| ||||||||||||||| | | |||||| ||||||||||||| ||||||| || ||| || ||||||| ||| ||||||||||| || |||| |
|
|
| T |
23232409 |
gtttcaggttcgattccctctggcgccaatttcggtgggctaagtccatacagagcttgcaagctctggctttaaatgggacccccgcaagtgggtggtg |
23232310 |
T |
 |
| Q |
231 |
agattggtcc |
240 |
Q |
| |
|
||||||||| |
|
|
| T |
23232309 |
ggattggtcc |
23232300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 213 - 279
Target Start/End: Original strand, 27542504 - 27542570
Alignment:
| Q |
213 |
ccccgcaagttggcggtgagattggtcccctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
|||||||| | ||||||||||||| ||||||| |||||||| || || ||||||||||| |||||| |
|
|
| T |
27542504 |
ccccgcaaatcggcggtgagattgatcccctcagattaatcagttgtttgatcggataccaagtttt |
27542570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 318 - 355
Target Start/End: Complemental strand, 902126 - 902089
Alignment:
| Q |
318 |
ctaatcaagctactaactctagttaacctatcaactaa |
355 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
902126 |
ctaaccaagctactaactctagtttacctatcaactaa |
902089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 318 - 355
Target Start/End: Complemental strand, 3282850 - 3282813
Alignment:
| Q |
318 |
ctaatcaagctactaactctagttaacctatcaactaa |
355 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
3282850 |
ctaaccaagctactaactctagtttacctatcaactaa |
3282813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 318 - 355
Target Start/End: Complemental strand, 3284551 - 3284514
Alignment:
| Q |
318 |
ctaatcaagctactaactctagttaacctatcaactaa |
355 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
3284551 |
ctaaccaagctactaactctagtttacctatcaactaa |
3284514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 318 - 355
Target Start/End: Complemental strand, 9312078 - 9312041
Alignment:
| Q |
318 |
ctaatcaagctactaactctagttaacctatcaactaa |
355 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
9312078 |
ctaaccaagctactaactctagtttacctatcaactaa |
9312041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 318 - 355
Target Start/End: Original strand, 37664737 - 37664774
Alignment:
| Q |
318 |
ctaatcaagctactaactctagttaacctatcaactaa |
355 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
37664737 |
ctaaccaagctactaactctagtttacctatcaactaa |
37664774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 318 - 355
Target Start/End: Original strand, 37674459 - 37674496
Alignment:
| Q |
318 |
ctaatcaagctactaactctagttaacctatcaactaa |
355 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
37674459 |
ctaaccaagctactaactctagtttacctatcaactaa |
37674496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 318 - 355
Target Start/End: Complemental strand, 37702235 - 37702198
Alignment:
| Q |
318 |
ctaatcaagctactaactctagttaacctatcaactaa |
355 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
37702235 |
ctaaccaagctactaactctagtttacctatcaactaa |
37702198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 141 - 240
Target Start/End: Complemental strand, 25237127 - 25237028
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacaga-atttgctttgactttaaacggggcccccgcaagttggcggtgagattggtc |
239 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||| ||||| ||||||| |||||| |||||| || || ||| |||||||| | ||||| ||||||| |
|
|
| T |
25237127 |
ggttcgattccctctagtgccaatttcggtgggc-aagtccatacagagttttgctctgacttagaatggtgcctccgcaagtggacggtggaattggtc |
25237029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 223 - 279
Target Start/End: Original strand, 37349663 - 37349719
Alignment:
| Q |
223 |
tggcggtgagattggtcccctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
||||||||||||||||| |||| |||||||| || |||||||| ||| |||||||| |
|
|
| T |
37349663 |
tggcggtgagattggtctcctcaaattaatcggttcttggatcgtatagcgagtttt |
37349719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 141 - 177
Target Start/End: Original strand, 44961832 - 44961868
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaa |
177 |
Q |
| |
|
|||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
44961832 |
ggttcgattctctctagtgtcaatttgggtgggctaa |
44961868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0070 (Bit Score: 85; Significance: 2e-40; HSPs: 1)
Name: scaffold0070
Description:
Target: scaffold0070; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 141 - 281
Target Start/End: Original strand, 40384 - 40523
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| ||| |||||| ||||||||||||| ||||||| ||||| || ||||||||||||||||||||||| ||||||| ||||||| | |
|
|
| T |
40384 |
ggttcgattccctctggtgccaatttcggtgggctaagtccatacagagcttgctctggctttaaacggggcccccgcaagtgggcggtgggattggt-c |
40482 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
40483 |
cctcggattagtcgattcttggatcggataccgagttttca |
40523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0102 (Bit Score: 84; Significance: 8e-40; HSPs: 1)
Name: scaffold0102
Description:
Target: scaffold0102; HSP #1
Raw Score: 84; E-Value: 8e-40
Query Start/End: Original strand, 142 - 281
Target Start/End: Original strand, 39152 - 39291
Alignment:
| Q |
142 |
gttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtccc |
241 |
Q |
| |
|
|||||||||||||| ||| |||||| ||||||||| ||| |||||||| ||| | || ||||||||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
39152 |
gttcgattccctctggtgccaatttcggtgggctatgtccatacagaacttgttctggctttaaacggggcccccgcaagtgggcggtgggattggtccc |
39251 |
T |
 |
| Q |
242 |
ctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
||||||||| |||||| ||||||| ||||||||||||||| |
|
|
| T |
39252 |
ctcggattagtcgattcttggatcagataccgagttttca |
39291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0019 (Bit Score: 81; Significance: 5e-38; HSPs: 1)
Name: scaffold0019
Description:
Target: scaffold0019; HSP #1
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 141 - 281
Target Start/End: Original strand, 161868 - 162008
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| ||| |||||| ||||||||||||| ||||||| ||||| || |||| || ||||||||||||||| ||||||| ||||||||| |
|
|
| T |
161868 |
ggttcgattccctctggtgccaatttcggtgggctaagtccatacagagcttgctctggcttttaatggggcccccgcaagtgggcggtgggattggtcc |
161967 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||||||| |||||| ||||||| ||||||||||||||| |
|
|
| T |
161968 |
cctcggattagtcgattcttggatcagataccgagttttca |
162008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0217 (Bit Score: 79; Significance: 8e-37; HSPs: 1)
Name: scaffold0217
Description:
Target: scaffold0217; HSP #1
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 141 - 279
Target Start/End: Complemental strand, 7447 - 7309
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
|||||||||||||| ||| |||||| ||||||||||||| ||||||| || || || ||||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
7447 |
ggttcgattccctccggtgccaatttcggtgggctaagtccatacagagctttctctggctttaaacggggcccccgcaagtgggcggtgggattggtcc |
7348 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
|||||||||| |||||| |||||||||||||| |||||| |
|
|
| T |
7347 |
cctcggattagtcgattcttggatcggataccaagtttt |
7309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026 (Bit Score: 75; Significance: 2e-34; HSPs: 1)
Name: scaffold0026
Description:
Target: scaffold0026; HSP #1
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 141 - 279
Target Start/End: Complemental strand, 97504 - 97366
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| ||| |||||| ||||||||||||| ||||||| ||||| |||||||||||||| ||||||||||| ||||||| ||||||||| |
|
|
| T |
97504 |
ggttcgattccctctggtgccaatttcggtgggctaagtccatacagagcttgctctgactttaaacgggacccccgcaagtgggcggtgggattggtcc |
97405 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
|||| |||| ||| || ||||| ||||||||||||||| |
|
|
| T |
97404 |
tctcgtattagtcggtttttggaccggataccgagtttt |
97366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0366 (Bit Score: 69; Significance: 7e-31; HSPs: 2)
Name: scaffold0366
Description:
Target: scaffold0366; HSP #1
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 141 - 281
Target Start/End: Complemental strand, 9437 - 9298
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| | | |||||| ||||||||||||| ||||||| ||||| || ||||||| ||||||||||||||| | ||||| ||||||||| |
|
|
| T |
9437 |
ggttcgattccctctggagccaatttcggtgggctaagtccatacagagcttgctctggctttaaatggggcccccgcaagtggacggtgggattggtcc |
9338 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
||||| |||| |||||| || |||||||||||||||||||| |
|
|
| T |
9337 |
cctcgaattagtcgattctt-gatcggataccgagttttca |
9298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0366; HSP #2
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 141 - 281
Target Start/End: Complemental strand, 12138 - 11999
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||| ||||| | | |||||| ||||||||||||| ||||||| ||||| || ||||||| |||| |||| ||||| | ||||| ||||||||| |
|
|
| T |
12138 |
ggttcgatttcctctggagccaatttcggtgggctaagtccatacagagcttgctctggctttaaatgggg-ccccacaagtggacggtgggattggtcc |
12040 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatc-ggataccgagttttca |
281 |
Q |
| |
|
||||| |||| || ||| || |||| |||||||||||||||| |
|
|
| T |
12039 |
cctcgaattagtcaattctt-gatcgggataccgagttttca |
11999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0051 (Bit Score: 69; Significance: 7e-31; HSPs: 1)
Name: scaffold0051
Description:
Target: scaffold0051; HSP #1
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 141 - 281
Target Start/End: Complemental strand, 53009 - 52869
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| ||| |||||| ||||||| || || ||||||| ||||| || |||||||||||||||||||| || |||||| ||||||||| |
|
|
| T |
53009 |
ggttcgattccctctggtgccaatttcggtgggcaaaatccatacagagcttgctctggctttaaacggggcccccgcaggtgggcggtaggattggtcc |
52910 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
||||||||| |||||| ||| ||||||||||||||||||| |
|
|
| T |
52909 |
tctcggattagtcgattcttgaatcggataccgagttttca |
52869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0623 (Bit Score: 67; Significance: 1e-29; HSPs: 1)
Name: scaffold0623
Description:
Target: scaffold0623; HSP #1
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 141 - 279
Target Start/End: Complemental strand, 1194 - 1057
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| | | |||||| ||||||||||||| ||||||| ||||| || ||||||| ||||||||||||||| | ||||| ||||||||| |
|
|
| T |
1194 |
ggttcgattccctctggagccaatttcggtgggctaagtccatacagagcttgctctggctttaaatggggcccccgcaagtggacggtgggattggtcc |
1095 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
||||| |||| |||||| || |||||||||||||||||| |
|
|
| T |
1094 |
cctcgaattagtcgattctt-gatcggataccgagtttt |
1057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0328 (Bit Score: 65; Significance: 2e-28; HSPs: 2)
Name: scaffold0328
Description:
Target: scaffold0328; HSP #1
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 141 - 279
Target Start/End: Complemental strand, 13182 - 13047
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| ||| |||||| |||||| |||||| ||||||| ||||| |||||||||||||||||||||||| | ||||| ||||| ||| |
|
|
| T |
13182 |
ggttcgattccctctggtgccaatttcggtgggttaagtccatacagagcttgct---actttaaacggggcccccgcaagtggacggtgggattgatcc |
13086 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
|||| ||||| | |||| ||||||||||||||||||||| |
|
|
| T |
13085 |
cctcagattagttgattcttggatcggataccgagtttt |
13047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0328; HSP #2
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 141 - 270
Target Start/End: Original strand, 15050 - 15178
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||| ||||||||| ||| ||||| |||||| |||||| || |||| ||||| || ||||||| ||| ||||||||||| ||||| | |||||||| |
|
|
| T |
15050 |
ggttcaattccctctggtgctaatttcggtgggttaagtccatccagagcttgctctggctttaaatgggccccccgcaagtgggcgg-gggattggtct |
15148 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggata |
270 |
Q |
| |
|
|||||||||| || ||| |||||||||||| |
|
|
| T |
15149 |
cctcggattagtcaattcttggatcggata |
15178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 65; Significance: 2e-28; HSPs: 1)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 141 - 281
Target Start/End: Original strand, 32347 - 32486
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||| ||||| | | |||||| ||||||||||||| ||||||| ||||| || ||||||| | ||||||||||||| || |||| ||||||||| |
|
|
| T |
32347 |
ggttcgatttcctctggagccaatttcggtgggctaagtccatacagagcttgctctggctttaaatgtggcccccgcaagtgggtggtgggattggtcc |
32446 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||||||| |||||| || |||||||||||||||||||| |
|
|
| T |
32447 |
cctcggattagtcgattctt-gatcggataccgagttttca |
32486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1175 (Bit Score: 58; Significance: 3e-24; HSPs: 1)
Name: scaffold1175
Description:
Target: scaffold1175; HSP #1
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 170 - 279
Target Start/End: Complemental strand, 2535 - 2426
Alignment:
| Q |
170 |
tgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcccctcggattaatcgattattggatcggat |
269 |
Q |
| |
|
||||||||||| ||||||| ||||| || ||||||||||||||||||||||| ||||||| ||||||||||||||||||| || | ||| ||||||| |
|
|
| T |
2535 |
tgggctaagtccatacagagcttgctctggctttaaacggggcccccgcaagtgggcggtgggattggtcccctcggattagtccgtccttgaatcggat |
2436 |
T |
 |
| Q |
270 |
accgagtttt |
279 |
Q |
| |
|
|||||||||| |
|
|
| T |
2435 |
accgagtttt |
2426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0068 (Bit Score: 57; Significance: 1e-23; HSPs: 1)
Name: scaffold0068
Description:
Target: scaffold0068; HSP #1
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 141 - 281
Target Start/End: Complemental strand, 41782 - 41643
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||||||||| || |||||| | || |||||||| ||||||| ||||| || |||||||||||||||| |||||| ||| || ||||||||| |
|
|
| T |
41782 |
ggttcgattccctcttgttccaatttcgttgtgctaagtccatacagagcttgctctggctttaaacggggcccctgcaagtgggcaatgggattggtcc |
41683 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
|||||||||| |||||| || |||||||||| ||||||||| |
|
|
| T |
41682 |
cctcggattagtcgattctt-gatcggatacagagttttca |
41643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0049 (Bit Score: 57; Significance: 1e-23; HSPs: 1)
Name: scaffold0049
Description:
Target: scaffold0049; HSP #1
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 191 - 279
Target Start/End: Original strand, 66863 - 66951
Alignment:
| Q |
191 |
ttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcccctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
||||| || ||||||||||||||||||||||| ||||||| ||||||||||||||||||| ||| | ||||||||||||||||||||| |
|
|
| T |
66863 |
ttgctctggctttaaacggggcccccgcaagtgggcggtgggattggtcccctcggattagtcggtccttggatcggataccgagtttt |
66951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0459 (Bit Score: 49; Significance: 6e-19; HSPs: 1)
Name: scaffold0459
Description:
Target: scaffold0459; HSP #1
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 141 - 281
Target Start/End: Complemental strand, 10831 - 10693
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
||||||||| ||||| | | |||||| ||||||||||||| ||||||| ||||| || ||||||| |||| |||| ||||| | ||||| ||||||||| |
|
|
| T |
10831 |
ggttcgatttcctctggagccaatttcggtgggctaagtccatacagagcttgctctggctttaaatgggg-ccccacaagtggacggtgggattggtcc |
10733 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagttttca |
281 |
Q |
| |
|
||||| |||| || ||| || |||||||||||||||||||| |
|
|
| T |
10732 |
cctcgaattagtcaattctt-gatcggataccgagttttca |
10693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0717 (Bit Score: 44; Significance: 6e-16; HSPs: 1)
Name: scaffold0717
Description:
Target: scaffold0717; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 141 - 236
Target Start/End: Complemental strand, 96 - 1
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattg |
236 |
Q |
| |
|
||||||||||||||| ||||||||| | ||||||||||| ||||||| |||||| | ||||||||||||||||| || || ||||||| ||||| |
|
|
| T |
96 |
ggttcgattccctcttatgtcaatttcgatgggctaagtccatacagagtttgctctagctttaaacggggcccccacatgtgggcggtgggattg |
1 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0157 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: scaffold0157
Description:
Target: scaffold0157; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 141 - 279
Target Start/End: Original strand, 20281 - 20418
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaagtcaatacagaatttgctttgactttaaacggggcccccgcaagttggcggtgagattggtcc |
240 |
Q |
| |
|
|||| |||||||||| ||| |||||| ||||||||||| ||||| | ||||| || ||||||||||| ||||||||||| |||||| | |||| | | |
|
|
| T |
20281 |
ggtttgattccctctggtgccaatttcaatgggctaagtccatacatagcttgctctggctttaaacgggacccccgcaagtgggcggtaaaattgat-c |
20379 |
T |
 |
| Q |
241 |
cctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
||||||||| || ||| ||||| ||||||||||||||| |
|
|
| T |
20380 |
tctcggattagtcaattcttggaccggataccgagtttt |
20418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0199 (Bit Score: 39; Significance: 0.0000000000006; HSPs: 1)
Name: scaffold0199
Description:
Target: scaffold0199; HSP #1
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 217 - 279
Target Start/End: Complemental strand, 8513 - 8451
Alignment:
| Q |
217 |
gcaagttggcggtgagattggtcccctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
|||||| ||||||| ||||||||| ||||||||| |||||| || |||||||||||||||||| |
|
|
| T |
8513 |
gcaagtgggcggtgggattggtccgctcggattagtcgattcttagatcggataccgagtttt |
8451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011 (Bit Score: 39; Significance: 0.0000000000006; HSPs: 1)
Name: scaffold0011
Description:
Target: scaffold0011; HSP #1
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 8 - 78
Target Start/End: Original strand, 17442 - 17512
Alignment:
| Q |
8 |
ctatatggaatcattcctcagatttgcttcttgaaaggaatttctgtatttccaaaggtaaactacggata |
78 |
Q |
| |
|
||||||||| || |||||||||||||||||||||| ||||| |||||| |||||||||||| || ||||| |
|
|
| T |
17442 |
ctatatggattcgttcctcagatttgcttcttgaagggaatacctgtatatccaaaggtaaaatatggata |
17512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0028 (Bit Score: 36; Significance: 0.00000000004; HSPs: 1)
Name: scaffold0028
Description:
Target: scaffold0028; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 215 - 278
Target Start/End: Original strand, 27903 - 27966
Alignment:
| Q |
215 |
ccgcaagttggcggtgagattggtcccctcggattaatcgattattggatcggataccgagttt |
278 |
Q |
| |
|
|||||||| || ||||||||| |||||||||||||| ||| || ||||||| |||||||||||| |
|
|
| T |
27903 |
ccgcaagtgggtggtgagatttgtcccctcggattagtcggttcttggatcagataccgagttt |
27966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0020 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0020
Description:
Target: scaffold0020; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 227 - 279
Target Start/End: Complemental strand, 123117 - 123066
Alignment:
| Q |
227 |
ggtgagattggtcccctcggattaatcgattattggatcggataccgagtttt |
279 |
Q |
| |
|
|||| |||||||||||||||||||||||| | |||||||||||||| |||||| |
|
|
| T |
123117 |
ggtgggattggtcccctcggattaatcga-tcttggatcggataccaagtttt |
123066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0300 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0300
Description:
Target: scaffold0300; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 141 - 177
Target Start/End: Original strand, 4407 - 4443
Alignment:
| Q |
141 |
ggttcgattccctctagtgtcaattttggtgggctaa |
177 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
4407 |
ggttcgattccctctagtgtcaatttgggtggactaa |
4443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University