View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1272-Insertion-7 (Length: 248)
Name: NF1272-Insertion-7
Description: NF1272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1272-Insertion-7 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 7 - 248
Target Start/End: Complemental strand, 1273173 - 1272937
Alignment:
| Q |
7 |
atataacagtgtatatactatggttgcatgaagtaaaggttggactacatatgatatgaaagttggtgcatctatcacttgcacacacactacactacac |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1273173 |
atataacagtgtatatactatggttgcatgaagtaaaggttggactacatatgatatgaaagttggtgcatctatcacttgcacacacactacact---- |
1273078 |
T |
|
| Q |
107 |
tccaatccaaaatcctccaacacttttttgaggtttgattattttcactttgttgtcatgtttatgtaacacgtgtttgttacactggcaacagcaaaga |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
1273077 |
-ccaatccaaaatcctccaacacttttttgaggtttgattattttcactttgttgtcatgtttatgtaacacgtgtttgttacactgacaacagcaaagc |
1272979 |
T |
|
| Q |
207 |
ttgattgatacatacatatagatgtagatataatatacagat |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1272978 |
ttgattgatacatacatatagatgtagatataatatacagat |
1272937 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University