View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1272-Insertion-8 (Length: 210)
Name: NF1272-Insertion-8
Description: NF1272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1272-Insertion-8 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 7 - 210
Target Start/End: Original strand, 42551210 - 42551418
Alignment:
| Q |
7 |
aaagggtaggctttgaggtatatttggttggttttattattagagaattatcacgacgtgaaggtttgcgaatatttgaagccatgtatagaac----aa |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| || |
|
|
| T |
42551210 |
aaagggtaggctttgaggtatatttggttggttttattattagagaattatcacgacgtgaaggtttgcaaatatttgaagccatgtatagaacaattaa |
42551309 |
T |
|
| Q |
103 |
agtagctttgctatatgaatatttcaagagaatacactcataagaaaattgatgaactatggagaaaag-ttgtatggtgcagaagtttagatataagca |
201 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
42551310 |
agtagatttgctatatgaatatttcaagagaatacactcataagaaaattgatgaactatggagaaaagagtgtatggtgcagaagtttagatataagca |
42551409 |
T |
|
| Q |
202 |
acatttata |
210 |
Q |
| |
|
||||||||| |
|
|
| T |
42551410 |
acatttata |
42551418 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University