View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12720_high_5 (Length: 240)
Name: NF12720_high_5
Description: NF12720
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12720_high_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 52591076 - 52590853
Alignment:
| Q |
1 |
tttcttaatccgtaagtgttactttataataccccctagaccttcactcagttttgtattttcaattagt-gcaatggcttcatatgtatgctactttca |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
52591076 |
tttcttaatccgtaagtgttactttataataccccctagaccttcactcagttttgtattttcaattagttgcaatggcttcatatgtatgctactttca |
52590977 |
T |
 |
| Q |
100 |
taatattctctatttatgtgtattttaataaaattctttttgaactttgatttcataattggttgataccagttaccccaaggattcagagaaaataatg |
199 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52590976 |
taatattttctatttatgtgtattttaataaaattcattttgaactttgatttcataattggttgataccagttaccccaaggattcagagaaaataatg |
52590877 |
T |
 |
| Q |
200 |
ctagctaggcaaactggtttgaca |
223 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
52590876 |
ctagctaggcaaactggtttgaca |
52590853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University