View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12720_low_9 (Length: 247)
Name: NF12720_low_9
Description: NF12720
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12720_low_9 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 235
Target Start/End: Original strand, 20352770 - 20353005
Alignment:
| Q |
1 |
tacatagagaacatcaatctatttatcgattgttctagatgactaattaactgacagctgtcagttcgttgaaggcagtttgacagctgtctacagatgt |
100 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20352770 |
tacatagagaacataaatctatttatcgattgttctagatgactaattaactgacagctgtcagttcgttgaaggcagtttgacagctgtctacagatgt |
20352869 |
T |
|
| Q |
101 |
catgagttagttacaagggagactattgactgtggtaagga-aacaggagctatcatgagctctagccaagcaattctgagctatcatgagctctagcta |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20352870 |
catgagttagttacaagggagactattgactgtggtaaggacaacaggagctgtcatgagctctagccaagcaattctgagctatcatgagctctagcta |
20352969 |
T |
|
| Q |
200 |
agctattcccttactacactttctacatgatgtcca |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
20352970 |
agctattcccttactacactttctacatgatgtcca |
20353005 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 14 - 91
Target Start/End: Original strand, 33622176 - 33622254
Alignment:
| Q |
14 |
tcaatctatttatcgattgttctagatgactaat-taactgacagctgtcagttcgttgaaggcagtttgacagctgtc |
91 |
Q |
| |
|
||||||||||||| ||||||||||| ||||| || ||||||||| |||| |||| ||| ||||||||||||||||||| |
|
|
| T |
33622176 |
tcaatctatttattgattgttctaggtgactgatctaactgacatctgttagttagttataggcagtttgacagctgtc |
33622254 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University