View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12721_high_20 (Length: 281)
Name: NF12721_high_20
Description: NF12721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12721_high_20 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 8 - 264
Target Start/End: Complemental strand, 563709 - 563453
Alignment:
| Q |
8 |
gagcagagaatgaatgcaaccattctagctgatgggattaaaattgctataaggccaatgattgataatgtgagtggtgttgtagaaaaagttgaaattg |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
563709 |
gagcagagaatgaatgcaaccattctagctgatgggattaaaattgctataaggccaacgattgataatgtgagtggtgttgtagaaaaagttgaaattg |
563610 |
T |
 |
| Q |
108 |
taaatgtcttgaagaggttaattgtagatgaaggaattgagattcgtggaagaatcaaagtactaaaagatgctgctgctaatgcaatgaaagtagatgg |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
563609 |
taaatgtcttgaagaggttaattgtagatgaaggaattgagattcgtagaagaatgaaagtactaaaagatgctgctgctaatgcaatgaaagtagatgg |
563510 |
T |
 |
| Q |
208 |
atcttccataatcattatgtcccaattggtcaccaaatggacaaagatggaaggttt |
264 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
563509 |
atcttccataatcactatgtcccaattggtcacaaaatggacaaagatggaaggttt |
563453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University