View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12721_high_21 (Length: 274)

Name: NF12721_high_21
Description: NF12721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12721_high_21
NF12721_high_21
[»] chr6 (2 HSPs)
chr6 (57-218)||(2996224-2996386)
chr6 (1-29)||(2980109-2980137)
[»] scaffold0011 (1 HSPs)
scaffold0011 (145-216)||(13415-13486)
[»] chr4 (1 HSPs)
chr4 (1-31)||(38885800-38885830)


Alignment Details
Target: chr6 (Bit Score: 123; Significance: 3e-63; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 57 - 218
Target Start/End: Complemental strand, 2996386 - 2996224
Alignment:
57 ggttggtggtggtagttttttggagttttcaagaaggcgtctctttatgaaatctttcatctccttttgccttggtggacctc-tgtgttcgtgactttt 155  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||| |||||||||||||| |||| || | ||||||||||||||||    
2996386 ggttggtggtggtagttttttagagttttcaagaaggcgtctctttatggaatctttcgtctccttttgcctttgtgggccccatgtgttcgtgactttt 2996287  T
156 ggagaagtgtaatttgcttttgcttgccactatcttgtattgattgctccaatgtgctattgt 218  Q
    |||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||    
2996286 ggagaagtgtgatttgcttttgcttgccactagcttgtattgattgctccaatgtgctattgt 2996224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 1 - 29
Target Start/End: Original strand, 2980109 - 2980137
Alignment:
1 gcaaaaccatgcaactcaaacccatcata 29  Q
    |||||||||||||||||||||||||||||    
2980109 gcaaaaccatgcaactcaaacccatcata 2980137  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0011 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: scaffold0011
Description:

Target: scaffold0011; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 145 - 216
Target Start/End: Complemental strand, 13486 - 13415
Alignment:
145 tcgtgacttttggagaagtgtaatttgcttttgcttgccactatcttgtattgattgctccaatgtgctatt 216  Q
    ||||||||||||||||||||| ||||| ||||||||||||||| ||||| ||||||||| |||||| |||||    
13486 tcgtgacttttggagaagtgtgatttgtttttgcttgccactagcttgtgttgattgcttcaatgttctatt 13415  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 31
Target Start/End: Original strand, 38885800 - 38885830
Alignment:
1 gcaaaaccatgcaactcaaacccatcataac 31  Q
    |||||||||||||||||||||||||||||||    
38885800 gcaaaaccatgcaactcaaacccatcataac 38885830  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University