View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12721_high_21 (Length: 274)
Name: NF12721_high_21
Description: NF12721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12721_high_21 |
 | |
|
| [»] scaffold0011 (1 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 123; Significance: 3e-63; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 57 - 218
Target Start/End: Complemental strand, 2996386 - 2996224
Alignment:
| Q |
57 |
ggttggtggtggtagttttttggagttttcaagaaggcgtctctttatgaaatctttcatctccttttgccttggtggacctc-tgtgttcgtgactttt |
155 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||| |||||||||||||| |||| || | |||||||||||||||| |
|
|
| T |
2996386 |
ggttggtggtggtagttttttagagttttcaagaaggcgtctctttatggaatctttcgtctccttttgcctttgtgggccccatgtgttcgtgactttt |
2996287 |
T |
|
| Q |
156 |
ggagaagtgtaatttgcttttgcttgccactatcttgtattgattgctccaatgtgctattgt |
218 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
2996286 |
ggagaagtgtgatttgcttttgcttgccactagcttgtattgattgctccaatgtgctattgt |
2996224 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 1 - 29
Target Start/End: Original strand, 2980109 - 2980137
Alignment:
| Q |
1 |
gcaaaaccatgcaactcaaacccatcata |
29 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
2980109 |
gcaaaaccatgcaactcaaacccatcata |
2980137 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: scaffold0011
Description:
Target: scaffold0011; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 145 - 216
Target Start/End: Complemental strand, 13486 - 13415
Alignment:
| Q |
145 |
tcgtgacttttggagaagtgtaatttgcttttgcttgccactatcttgtattgattgctccaatgtgctatt |
216 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||||||||||||| ||||| ||||||||| |||||| ||||| |
|
|
| T |
13486 |
tcgtgacttttggagaagtgtgatttgtttttgcttgccactagcttgtgttgattgcttcaatgttctatt |
13415 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 31
Target Start/End: Original strand, 38885800 - 38885830
Alignment:
| Q |
1 |
gcaaaaccatgcaactcaaacccatcataac |
31 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
38885800 |
gcaaaaccatgcaactcaaacccatcataac |
38885830 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University