View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12721_high_23 (Length: 264)
Name: NF12721_high_23
Description: NF12721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12721_high_23 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 229; Significance: 1e-126; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 18 - 254
Target Start/End: Complemental strand, 49277564 - 49277328
Alignment:
| Q |
18 |
gatggaactaaagttatggctcttggtgctggtattgaagaaccttattatgttagatttcagaaggcttccacttttactcagaacaagaatcaagatt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49277564 |
gatggaactaaagttatggctcttggtgctggtattgaagaaccttattatgttagatttcagaaggcttccacttttactcagaacaagaatcaagatt |
49277465 |
T |
 |
| Q |
118 |
tcagcggtgtctagtttgacacattgtatttgtggttagagagtacttgttatgttttaagatttgccaccctttcttgtcataagtgaaatgaaattca |
217 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49277464 |
tcagcggtgtctagtttggcacattgtatttgtggttagagagtacttgttatgttttaagatttgccaccctttcttgtcataagtgaaatgaaattca |
49277365 |
T |
 |
| Q |
218 |
acctttatgtctactatctgtctcaaatttatctgtg |
254 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
49277364 |
acctttatgtctaatatctgtctcaaatttatctgtg |
49277328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 18 - 127
Target Start/End: Complemental strand, 49271647 - 49271538
Alignment:
| Q |
18 |
gatggaactaaagttatggctcttggtgctggtattgaagaaccttattatgttagatttcagaaggcttccacttttactcagaacaagaatcaagatt |
117 |
Q |
| |
|
||||||||||||||||||||| |||||| |||||||||||||||||| |||||||||||||||||||||||||||||| |||||| ||| |||||||||| |
|
|
| T |
49271647 |
gatggaactaaagttatggctgttggtgatggtattgaagaaccttactatgttagatttcagaaggcttccacttttgctcagagcaataatcaagatt |
49271548 |
T |
 |
| Q |
118 |
tcagcggtgt |
127 |
Q |
| |
|
| ||| |||| |
|
|
| T |
49271547 |
tgagcagtgt |
49271538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 18 - 99
Target Start/End: Complemental strand, 49269199 - 49269115
Alignment:
| Q |
18 |
gatggaactaaagttatggctcttggtgctggtattgaa---gaaccttattatgttagatttcagaaggcttccacttttactc |
99 |
Q |
| |
|
||||||||||||||||||||| |||||| ||||| ||| ||||||||||||||||| ||||||| || |||||||||||||| |
|
|
| T |
49269199 |
gatggaactaaagttatggctgttggtgatggtaatgatcttgaaccttattatgttaggtttcagagggtttccacttttactc |
49269115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University