View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12721_high_35 (Length: 204)

Name: NF12721_high_35
Description: NF12721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12721_high_35
NF12721_high_35
[»] chr6 (1 HSPs)
chr6 (81-176)||(3256358-3256453)


Alignment Details
Target: chr6 (Bit Score: 96; Significance: 3e-47; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 81 - 176
Target Start/End: Original strand, 3256358 - 3256453
Alignment:
81 gtgtaacacatgcagaaattaacctcagctgtagaagaagtcgaaagaagcctctctttttcccttcttttcttcatcggcaaggcaaaaacccta 176  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3256358 gtgtaacacatgcagaaattaacctcagctgtagaagaagtcgaaagaagcctctctttttcccttcttttcttcatcggcaaggcaaaaacccta 3256453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University