View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12721_high_35 (Length: 204)
Name: NF12721_high_35
Description: NF12721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12721_high_35 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 96; Significance: 3e-47; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 81 - 176
Target Start/End: Original strand, 3256358 - 3256453
Alignment:
| Q |
81 |
gtgtaacacatgcagaaattaacctcagctgtagaagaagtcgaaagaagcctctctttttcccttcttttcttcatcggcaaggcaaaaacccta |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3256358 |
gtgtaacacatgcagaaattaacctcagctgtagaagaagtcgaaagaagcctctctttttcccttcttttcttcatcggcaaggcaaaaacccta |
3256453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University