View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12721_low_15 (Length: 324)
Name: NF12721_low_15
Description: NF12721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12721_low_15 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 131; Significance: 6e-68; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 131; E-Value: 6e-68
Query Start/End: Original strand, 56 - 229
Target Start/End: Complemental strand, 2979373 - 2979203
Alignment:
| Q |
56 |
ctaagcatatttacgtgatgtgtgacgttgaaacaaatatatgaaggaagcgacgaagcttcctacttttccggtgttattaaaaaagtttgggatgaat |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
2979373 |
ctaagcatatttacgtgatgtgtgacgttgaaacaaatatatgaaggaagcgac---gcttcctacttttccggtgttattaaacaagtttgggatgaat |
2979277 |
T |
|
| Q |
156 |
taaatatttgatttnnnnnnntgaaaattacatatatacccattacttgttttaaagaaagattggtttatggt |
229 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
2979276 |
taaatatttgatttaaaaaaatgaaaattacatatatacccattagttgttttaaagaaagattggtttatggt |
2979203 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 248 - 286
Target Start/End: Complemental strand, 2979194 - 2979156
Alignment:
| Q |
248 |
ctaataggtgtaggtttaggtcgatgatttactctttca |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2979194 |
ctaataggtgtaggtttaggtcgatgatttactctttca |
2979156 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University