View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12721_low_23 (Length: 272)
Name: NF12721_low_23
Description: NF12721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12721_low_23 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 19 - 262
Target Start/End: Complemental strand, 40866789 - 40866546
Alignment:
| Q |
19 |
tttattgggtgcactcaaggctatgataattggtatgaaagtcctaagcctaaccctaatattctcatcggtgcccttgttggtggacctgataataagg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40866789 |
tttattgggtgcactcaaggctatgataattggtatgaaagtcctaagcctaaccctaatattctcatcggtgcccttgttggtggacctgataataagg |
40866690 |
T |
 |
| Q |
119 |
accaatttagagatgaaagaagaaattttgaacagttggaggcttgtacctacaatactgctgcacttgtaggagtttttgctagattgtataatttaga |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40866689 |
accaatttagagatgaaagaagaaattttgaacagttggaggcttgtacctacaatactgctgcacttgtaggagtttttgctagattgtataatttaga |
40866590 |
T |
 |
| Q |
219 |
ataataaggtgatgtttaatgtatttgttgatgaaccacctttg |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40866589 |
ataataaggtgatgtttaatgtatttgttgatgaaccacctttg |
40866546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University