View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12721_low_37 (Length: 221)
Name: NF12721_low_37
Description: NF12721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12721_low_37 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 29 - 208
Target Start/End: Original strand, 34315556 - 34315736
Alignment:
| Q |
29 |
ttcaaaaatttatctacatttgagagaaagatggcattcctctaatccaagttatcaattagtttttacaagagatagacaatagttaccnnnnnnncta |
128 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||| | ||| |
|
|
| T |
34315556 |
ttcaaaaatttatctacatttgagagaaagatggcatccctctaatccatgttatcaattagtttttacaagagatagacaatagttatcaaaaaaacta |
34315655 |
T |
 |
| Q |
129 |
gcttcaaaagactggtttgaatagaccagaccc-aaggtatttagaattttcatgaatgaaagttgcatatgcaattcttg |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
34315656 |
gcttcaaaagactggtttgaatagaccagacccaaaggtatttagaatttttatgaatgaatgttgcatatgcaattcttg |
34315736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University