View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12722_high_14 (Length: 266)
Name: NF12722_high_14
Description: NF12722
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12722_high_14 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 5 - 224
Target Start/End: Complemental strand, 12635863 - 12635645
Alignment:
| Q |
5 |
agaagcaaaggcagggagagggaacacgaagagaagttaataactcttgtgagagagcgaacaccattgaagaagaaactcaaaaggagttttggattga |
104 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
12635863 |
agaatcaaaggcagggagagggaacacgaagagaagttaataactcttgtgagagagcgaacaccatcgaagaaaaaactcaaaaggagttttggattga |
12635764 |
T |
|
| Q |
105 |
cggatttgtggtggatatctagggtaggtaaacacaatattggatagtgattatatttgagagaggaaagaagataaattaataaggatttctcttggta |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
12635763 |
cggatttgtggtggatatctagggtaggtaaacgcaatattggatagtgattatatttgagagaggaaagaagataaattaataagga-ttctcttggta |
12635665 |
T |
|
| Q |
205 |
ggaaattgaagatgattttg |
224 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
12635664 |
ggaaattgaagatgattttg |
12635645 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University