View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12722_high_19 (Length: 240)
Name: NF12722_high_19
Description: NF12722
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12722_high_19 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 19 - 227
Target Start/End: Original strand, 15548702 - 15548910
Alignment:
| Q |
19 |
ctgatatggtgggattctgttcctaattaagtagtacttaattagttttaaacatgggtttgtatgtgtgtaaaacatttgtgttccaataaaattattc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
15548702 |
ctgatatggtgggattctgttcctaattaagtagtacttaattagttttaaacatgggtttgtatgtgtgtaaaacatttgtgttccaataacattattc |
15548801 |
T |
|
| Q |
119 |
taaaaattcctcactttattgagtttagttgatacatcagaaaagaaacgctcattttaagttgtataaataaagggggacatctattgtcataaaaagg |
218 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
15548802 |
taaaaattcctcactttaatgagtttagttgatacatcagaaaagaaacgctcattttaagttgtataaataaaaggggacatctattgtcataaaaagg |
15548901 |
T |
|
| Q |
219 |
atttcttct |
227 |
Q |
| |
|
||||||||| |
|
|
| T |
15548902 |
atttcttct |
15548910 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University