View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12722_high_20 (Length: 240)
Name: NF12722_high_20
Description: NF12722
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12722_high_20 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 53402510 - 53402290
Alignment:
| Q |
1 |
tgaagtgctaacgtgtatgcaaacatctttcactccgtcgtaaagattgcaccgccaccgtactggaacactgtccgccattgtcaccttcatccgttta |
100 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||||||||||||||||||||||||| ||| || ||||||| |||||||||||||||||||||||||| |
|
|
| T |
53402510 |
tgaaatgctaacgtgtatgcaaaaatctttcactccgtcgtaaagattgcaccgccactgtattgaaacactgcccgccattgtcaccttcatccgttta |
53402411 |
T |
 |
| Q |
101 |
ttaccggacaaatcatttatcgtcaccatgttggaacaccgcacacgactgttgccttcatttgttcattactggacaaatcaaatcttaaacatatctt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53402410 |
ttaccggacaaatcatttatcgtcaccatgttggaacaccgcacacgactgttgccttcatttgttcattactggacaaatcaaatcttaaacatatctt |
53402311 |
T |
 |
| Q |
201 |
ctttcttctaaagaatccttt |
221 |
Q |
| |
|
||||||||| | ||||||||| |
|
|
| T |
53402310 |
ctttcttctgatgaatccttt |
53402290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University