View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12722_high_25 (Length: 222)

Name: NF12722_high_25
Description: NF12722
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12722_high_25
NF12722_high_25
[»] chr1 (1 HSPs)
chr1 (20-211)||(10132812-10133003)


Alignment Details
Target: chr1 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 20 - 211
Target Start/End: Complemental strand, 10133003 - 10132812
Alignment:
20 tttatatgcatgactctggaacttgcatatttttcaatactttaagaataggttaggaatttcacatgagannnnnnnggttaaacatgttattacttta 119  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||||    
10133003 tttatatgcatgactctggaacttgcatatttttcaatactttaagaataggttaggaatttcacatgagatttttttggttaaacatgttattacttta 10132904  T
120 ttggggtaaagtattactgtctgtttttgccacctttagtagttattatgctcggaactatgactgaccatctttagtggagtctctgctcc 211  Q
    ||||||||||||||||| ||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||| ||||||||||    
10132903 ttggggtaaagtattacagtctgtttttgccacctttagtagttactatgctcagaactatgactgaccatctttagtggaatctctgctcc 10132812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University