View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12722_high_3 (Length: 390)
Name: NF12722_high_3
Description: NF12722
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12722_high_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 181; Significance: 1e-97; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 181; E-Value: 1e-97
Query Start/End: Original strand, 100 - 373
Target Start/End: Original strand, 39780289 - 39780563
Alignment:
| Q |
100 |
tataccgaatttgatagacaattgtcgcattaatttatttcaaatgtgtgtcattgttcacatgactctctgttttcagtttnnnnnnnncacggctcgt |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
39780289 |
tataccgaatttgatagacaattgtcgcattaatttatttcaaatgtgtgtcattgttcacatgactctctgttttcagtt-aaaaaaaacacggctcgt |
39780387 |
T |
|
| Q |
200 |
tgtgttagtcacatcatttaacttgaatggaaaataacattcgaggccaaacatcttgaattacaagaagatgatcannnnnnnnnnnnnnnngcacaaa |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
39780388 |
tgtgttagtcacatcatttaacttgaatggaaaataacattcgaggccaaacatcttgaattacaagaagatgatcattttattttattttttgcacaaa |
39780487 |
T |
|
| Q |
300 |
tagaatccgaaagtgttcatat--tatagtaaaatattttgcaggttcaagaaaaggttgagtttagtcattggtg |
373 |
Q |
| |
|
||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39780488 |
tagaatctgaaagtgttcatattatatagtaaaatattttgcaggttcaagaaaaggttgagtttagtcattggtg |
39780563 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University