View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12722_low_12 (Length: 301)
Name: NF12722_low_12
Description: NF12722
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12722_low_12 |
 |  |
|
| [»] scaffold0591 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 87; Significance: 1e-41; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 176 - 293
Target Start/End: Complemental strand, 15170007 - 15169889
Alignment:
| Q |
176 |
cagttaacggctgctccgtacccaacggcagttaatttttgttgtcctagcg-cagttaattgttgttacgttcttttcaagcataactagcaactcatt |
274 |
Q |
| |
|
|||||||| |||||| ||| ||||||||| |||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15170007 |
cagttaactgctgctttgtatccaacggcaattaattttggttgtcctagcggcagttaattgttgttacgttcttttcaagcataactagcaactcatt |
15169908 |
T |
 |
| Q |
275 |
ttttccatttcacaaaact |
293 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
15169907 |
ttttccatttcacaaaact |
15169889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 8 - 100
Target Start/End: Complemental strand, 15170142 - 15170050
Alignment:
| Q |
8 |
ggagaagcaaaggcagaatcggagaaggagaaaatggagagtgggtggttccattgagatagagaagaggacatgtgtttgggttggattgtg |
100 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
15170142 |
ggagaagcaatggcagaatcggagatggagaaaatggagagtgggtggttccattgagatagagaagaggacatgtgtttgggttgaattgtg |
15170050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 116 - 147
Target Start/End: Complemental strand, 15170038 - 15170007
Alignment:
| Q |
116 |
tggtttggagtgtttgaaaatttctcttctcc |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
15170038 |
tggtttggagtgtttgaaaatttctcttctcc |
15170007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0591 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0591
Description:
Target: scaffold0591; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 269 - 301
Target Start/End: Original strand, 2131 - 2163
Alignment:
| Q |
269 |
ctcattttttccatttcacaaaactgaatctct |
301 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |
|
|
| T |
2131 |
ctcattttttccatttcacaaaactcaatctct |
2163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University